Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3956
Length(NT) : 562
Best Gene Model Blast : Link to GSTUMT00010964001 E-value : 3e-88
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3956
CGGCCAATCCACCGAGATCGTCACAATGATTAGAAATATCGCGGATAAGA
ATATCGACTCTGATGACGAAGGGGATGATGGAGAAGGGGAGGTTGTTGCG
TTGGCCCGGCGTTCTGCGGATTTATTGAGTGGGGGGAGTGGTACTTTCGG
GAAGGCTCAGTAAATGGAGGATACCGGGCGAACCTCAGTGTTACTGGGTT
CATCGTTTGACTGGATTTTTGATGGGCGTTCGTTGGGATATTGACATCGA
TTCTCTTTGCGTCTGCGCGCTTATTCTACAGGTGTCAATACGTCTGTATC
ACTAAGTCGTGTTGAGCAGGTTTATGGGTCACGAGTTTTCTTGATTTTTG
CAATATGGTGTTTTCCGGTCGAGCGTTGGAGATTCACAAGATGGGTGCTA
AATTGCCACACTCAAAAACAAAAAAAAAAAAAAAAAAGACCTCGAGCTTT
GCTGTTCATGTTCAGGGTTTGAGGCATCACTTTATTCACAAGCATACGGG
GTTTCAACGGGAATGGCTATTTATTTTTTTTTTATATCTATATCTGTTTT
TAGTAGCTTTAT

Sequences in the Contig:

SY0AAB5YO09FM1 SY0AAC20YH10RM1