Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3955
Length(NT) : 1314
Best Gene Model Blast : Link to GSTUMT00001731001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: malate dehydrogenase, NAD-dependent
Accession: ref|XP_001261521.1| Score: 1253 E_value: 1e-136
KEGG Definition: NAD-dependent malate dehydrogenase [EC:1.1.1.37]; K00026 malate dehydrogenase
Accession: aor:AO090005000438 Score: 1252 E_value: 1e-136
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1494 Score: 1235 E_value: 1e-136
PFAM Definition: Ldh_1_N, lactate/malate dehydrogenase, NAD binding domain. L-lactate dehydrogenases are metabolic enzymes which catalyse the conversion of L-lactate to pyruvate, the last step in anaerobic glycolysis. L-2-hydroxyisocaproate dehydrogenases are also members of the family. Malate dehydrogenases catalyse the interconversion of malate to oxaloacetate. The enzyme participates in the citric acid cycle. L-lactate dehydrogenase is also found as a lens crystallin in bird and crocodile eyes. N-terminus (this family) is a Rossmann NAD-binding fold. C-terminus is an unusual alpha+beta fold..
Pfam Number: pfam00056 Score: 437 E_value: 9e-44
Swissprot: Q9Y7R8|MDHM_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig3955
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCACCTTTCCCCTCACATTT
CTCCTTCTTCTGTCCATAGTAGACATTACCCCCTCTCTCTCAGTCTTCAT
CCAAACATCTCGATCATATCCATTGTTATCATGTTTACCGCTAGATCAGC
TTTCTCGGCCATTGGAAGACGTGCCTTCTCTGTTTCTGCTCAGCAGAACT
CCAAGGTTACTGTTCTGGGAGCTGCTGGTGGCATTGGCCAACCTCTATCT
CTACTTCTCAAGCTCAATCCTAGAGTTAGCGAGTTGGCCTTGTACGATAT
CCGGGGTGGACCAGGTGTTGCTGCCGATATTTCTCATGTTAACACAAAAA
GCAAAGTTACCGGCTATGACGCGGTCCCCGAACAATTAAAGGCTGCACTC
GAGGGTGCCGATATTGTCCTTATCCCTGCTGGTGTTCCCCGCAAGCCCGG
AATGACCCGTGACGATCTTTTCAAAACCAATGCCTCCATCGTTCGTGACC
TGGCCAAGGCCGCTGCCAACCATGCGCCTAATGCTAAGCTCCTTATCATC
TCCAACCCCGTCAACTCTACCGTCCCTATCACTGCAGAAGTCTTTAAGTC
CAAGGGTGTCTACAACCCCAAGCGCCTCTTTGGTGTTACCACTTTGGATG
TTGTCCGCGCTTCGAAATTCATCTCTGAGATCCAGGGAACCGATCCCGCC
AATGAAGAGGTCACCGTTATCGGTGGCCACTCCGGCGTCACCATCGTTCC
TCTCCTATCCCAGTCAAACCACCCCTCTATTGACGGCGAGACCAGAGAGG
CCCTCGTGAAACGTATCCAGTTTGGTGGTGACGAGGTTGTCGAGGCTAAG
GGTGGTGCCGGTTCTGCTACCCTCTCTATGGCTTTCGCTGGGAGCCGGAT
GGCGGATTCCCTTCTACGTGCTTCATATGGTGAAACCGGGATCTTTGAGC
CTGCCTTTGTCCAGAGCCCGCTCTACAAGGACGATGGCTGTGAATTCTTC
TCCTCCAGGATTGAGTTGGGTCCGGAGGGTGTTAAGGAGATCCACCCTGT
CGGAAAGGTCAGCAAGTATGAGGAGGGACTGATTGCAACTGCCCTCAAGG
ACCTTGCGACCAATATCAAGAAGGGCCAGGAATTTGTTAAGGCAAACCCA
TAAGTAGGCAATGGCTGGATTCCTTGAAGGGAGTTACACGGTTTGTTTCG
TACGTCGTGATTTACATGTGTTTTCTTTAGTGTCCGTAGACCGCGGGGAT
ATGTGTTAAATGTCTCATACCCTTGAACCAAAATAAATAAATAAATATTT
TTTAAAAAAACTCG

Sequences in the Contig:

SY0AAA47YH21FM1 SY0AAA4YA01FM1 SY0AAB13YB10FM1
SY0AAB28YH09FM1 SY0AAB34YJ07FM1 SY0AAC20YG23FM1
SY0AAC20YG23RM1 SY0AAC38YP05FM1 SY0AAC44YD14FM1
SY0AAD33YA11FM1 SY0AAD52YM22FM1 SY0AAD56YE12FM1
SY0AAD60YN04FM1 SY0AAD7YP09FM1