Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3954
Length(NT) : 954
Best Gene Model Blast : Link to GSTUMT00011464001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_08403
Accession: ref|XP_001590663.1| Score: 184 E_value: 5e-12
KEGG Definition: hypothetical protein
Accession: ncr:NCU05906.1 Score: 171 E_value: 8e-11
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 111 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>Contig3954
TTGGACACCACCAGCGCAACTCGCAATGGATTCAACAACGAAAGCAATAG
ACCCCTACGGCGACGTCATAGTTCTCCTCCCCACTGCCACCGCCACAACC
AAACTTCGGGTATCCTCGAAAATTCTATCCACCGCATCTCTCGTCTTCCG
CTCAATGTTTTCCCGTCGCTACCGCGAAGGTGCCGCTCTCGCTTCAACCA
CGGCTTTGGTAGAAATAGAATTCCCGGACGACCCCCCGCAAGCGCTGGAG
GCCGTATTCAACGTGCTGCACTTCCGACATGACTGTGTGAGCGCGGACGT
TAGCCATGATGTCCTCTACGAGATTGCGCTCGTAGCGGATAAGTATGATC
TCGTGGTGGCGCTGGGACCGTGGAAGGAGGTTTGGCTGAGGGGGGGGGCG
GGCGGTGGTGGGAGGGGGTTGTTTGTCTTGTATGTGCTTGACGGCAAGGA
GGGGTTTAGGGAGGGGTGTCGAAGGGCGGTTATGCAGGATTTGGGGTGCG
GTGATGATGGTGATGGTGAGAATGATGGGGGAAAGGGAGAGAAGGGGGGG
GAGAATGTATGGGATTACGATGTGCTTCCAGAGAAACTTGTCGGTATGAT
ATATGATACATCCCACCATACCATGGTACCTGCCATTATAGTTAATATTA
CATATATGATACTAGGATTAATCTCGGCATACCGAATATCAACCATCAAA
TCCCTCCTCTCGGTAACAGCGCAGTTCAGGAGCCTATACCAAGGCCCCGG
CATGAAATGCAAACTCACTAGGCCGTCAACCGCGTTCCTCTCCAACGAAA
AAGCCCTCATTTGCGACGCTGCGATCCTAGGCTCGCTGATCCGGCACGAG
GCTGCCATCGGAATATTCCCCGTGCCCTCACCGCCGTATAATGGGATCTC
AGTCGAGAGCCTAGCCCTGTCAATGAAGAAACTCCTCTGCTTCGTAGACA
TTAC

Sequences in the Contig:

SY0AAA57YH04FM1 SY0AAC20YG07FM1 SY0AAC38YG12FM1