Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3952
Length(NT) : 934
Best Gene Model Blast : Link to GSTUMT00010888001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: tRNA-splicing endonuclease subunit Sen54 (predicted)
Accession: ref|NP_587697.1| Score: 404 E_value: 2e-37
KEGG Definition: hypothetical protein
Accession: spo:SPCC613.09 Score: 404 E_value: 7e-38
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG4772 Score: 350 E_value: 7e-34
PFAM Definition: No Hit Found
Swissprot: O74908|SEN54_SCHPO
Gene Ontology:
GO:0031966 = Cellular component: mitochondrial membrane

Sequence:
>Contig3952
TTGGATCCCGCCACCCCCACCACCAACTATTTGGTTCAACGATATTAATT
CCCTACAGCAACAGACTGTGTGAGAGAAAATAGTACTCAATGGACGAACC
AGAAGACGGTAACATTCGCAACGCTCAGAACAATATTCAAGATGCCGATC
TCTCGGATGAGACACAAGACTTTCGCTTCCTAAATCTCCTCAACAAGTAA
TCCCCTCTTCCCTCTCCTTTACCCTTTCCGATATTCACAACCCTCTAGAA
CAGGAACCACAGCTCTCCCCCGCCGCGGCGAGAAAGACTTTGAACCGGAC
GGCACCGACCTCCAAGACCGCGTCCTGAACGAGTCCCGGCAGGCGATGCA
CGAAGCACTCCTAGGGGAGCGTAAGCACTCCAGCAAACAGCACGTATCAG
CAACCTGGCGGCCATCACAGCGCATGGCAGAAGTTCACGTGGCTCGGGGG
CCGCACTTCAAGACGGTCGGGAAAGCCGACAGACGGGGGGTGTTGTGGTT
GCTGCCGGAGGAGACGATTTACCTGGTTGAAAGAGGGAACCTGGAATGTT
GGTGGGAGGAGGGCGTGCCGATGAGTTTGCAGGGGGTGTATGCTAGTGCG
CTTGATGGGTGTGGGGGGTTGGAGAGGTATCAAGTGTATACATATTTGAA
GAGGGCAGGGTATATTCTTGCGCGGGCGCCAACTTTCTTCCACGATGACG
ACAAGGTAGTAGAGCGGGAGGAAAGGGGAGAGGGAATAATTGGAACAATC
CGACCTGCGACAACTACACCACCCGGCATCTTCAAGCAGCTCTTCACAAG
CCTCTTCCTAACGCGCACAAAACCACCTCCCTTCGGCCCAGTAATCGCTC
AAGGAACCTACCGCACATACGACTCCATCTACTCCCGCCTATCAATAATC
CCCACCCACCACCCTCCGCACACCCCTACCAACA

Sequences in the Contig:

SY0AAC20YF16FM1 SY0AAC45YL19FM1 SY0AAD61YM15FM1