Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3950
Length(NT) : 690
Best Gene Model Blast : Link to GSTUMT00009432001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: mitochondrial carrier protein, putative
Accession: ref|XP_001269392.1| Score: 531 E_value: 5e-66
KEGG Definition: mitochondrial carrier protein, putative
Accession: afm:AFUA_1G07710 Score: 534 E_value: 3e-66
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0758 Score: 157 E_value: 1e-11
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 156 E_value: 1e-11

Sequence:
>Contig3950
TTGGGCCGGAAATACAGGAAATAGTTGACGGAGGTGGGTCGGGAAGGAAA
CCGCAGAATAACCTTGTGCAGGGGACCTCAGCGGCGGGAGCCAGAGCTTT
GGGAGCACAGATCATCGCATTCTACTTCCGGGCTCCGGTAAAGGCGTTTT
TCAGACTACGGGTGGATTATATGGGCTATAAATCCAAGAGTGCAAGCGAA
TGAACGATGGTCGTTAAGACAGTCCACTCCTGGGCTTCTATTTCATGCGG
TAAAGCACCACGGATGGAAGTTCATTCCTAACCAAGTTCTCCCACCACTA
GTAGCAAATGCAACCATCGGTACGATCCTCTACACTTCGTACCTACAGGT
CCTTGGAAGCCTTTACCAACCTTCCTCACAACCTACAAAACGAGTCTACC
CACCACCCCCGTTCAGTGCGGCCTTCCAAGCCGGCTCTGCAGCTGGAGCC
ATTCAATCCCTCGTTGCGGCACCCCTCGACGCCCTAGTAGTCCGCTTCCG
AGTAAACGACATGCTAGAAGGAAAGTACACATCTATGTGGCAATACGGAA
AGCACAAACTTCACGAGATCGGCCTCCGAGGGGTTTTCTCGGGTTACACA
CTCTCCTTCCTGAAAGAGTCCCTTGGATACGGCCTTTTCTTTGGATCGTT
CGAGTACGTTAAACAACAAGCTTACTTCTCATACTTGACA

Sequences in the Contig:

SY0AAC20YE13FM1 SY0AAC60YE04FM1 SY0AAC7YL12FM1