Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig395
Length(NT) : 339
Best Gene Model Blast : Link to GSTUMT00005101001 E-value : 1e-131
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An01g03570
Accession: ref|XP_001388787.1| Score: 277 E_value: 2e-23
KEGG Definition: hypothetical protein
Accession: ang:An01g03570 Score: 277 E_value: 8e-24
KOG Definition:
Classification: [Coenzyme transport and metabolism, Energy production and conversion].
Kog Number: KOG0534 Score: 136 E_value: 8e-10
PFAM Definition: No Hit Found
Swissprot: P36060|MCR1_YEAST
Gene Ontology:
GO:0031307 = Cellular component: integral to mitochondrial outer membrane
GO:0005758 = Cellular component: mitochondrial intermembrane space
GO:0004128 = Molecular function: cytochrome-b5 reductase activity
GO:0005515 = Molecular function: protein binding
GO:0006118 = Biological process: electron transport
GO:0006696 = Biological process: ergosterol biosynthetic process
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>Contig395
CAGGGATTGGTATTTCCCCTTCCGTGCAACGAAGCGATATGGTAATAGCG
AAGGGGGAAAAATAAAGAAGCTTATCCGCCGGATTTCTAAAACTTCCCCT
CAATCTAAAATTTGTAAACCTCCTCCTTCTTATACCCCAACTCCTTCAAC
ACCCCCTCCACCTCCCCTTGATCCGAGGGACTATTCTTAACGCCACTGAT
TGCCTTGTACATCCCCGGAGGACCACACACGAATATCTTATTATTCCCAC
TGCCCGGTTCCGGCAACACCGTCTTGAGCAACTCCTTCGTCACGCGTCCC
TGTGTGGCCCGCCTCGACCCCTTCGGCGCATTATCTAGC

Sequences in the Contig:

SY0AAA22YN02RM1 SY0AAD49YC11FM1