Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3948
Length(NT) : 337
Best Gene Model Blast : Link to GSTUMT00004309001 E-value : 2e-78
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3948
CCCAATATCAGATAACTTTTATTCAATTGTGCAAACACCCCACGTCTCTC
GTAGCTAGCCTCACATCCATCCATCCCTCATCGACCGGGCAAATAAAAAT
AAGGCCAAATGAACCCAACCGCTAATGCAAAACCCCCATTTCCAATTCCC
TAAGCCTACAACGAAAGCCCCATCTCACGAGGAAGGACAAAAAGCACAAT
CGCACATCCGCTACTCCCACTCCTCCTCCTTCCTCTGCTTCCCCTCGCCC
TACCATCTCTGGACCTCTCCAGCAGGCCTATTCTTCCTTGAGCCGCCACT
CAAGCCACGGAGGCGCCACCGTCCAGCTTGTCCCTTC

Sequences in the Contig:

SY0AAC20YE03RM1 SY0AAC28YA12RM1 SY0AAC61YC18FM1