Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3947
Length(NT) : 601
Best Gene Model Blast : Link to GSTUMT00006984001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG05358.1
Accession: ref|XP_385534.1| Score: 161 E_value: 1e-09
KEGG Definition: hypothetical protein
Accession: fgr:FG05358.1 Score: 161 E_value: 5e-10
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 123 E_value: 7e-08
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 106 E_value: 7e-06

Sequence:
>Contig3947
TTGGCTCCCTTCTTCCCACACAACCTTATTCAAGACAAACCCACTCACCG
CCAGACAGGGTTCTTTTTTTTTTTTTCCTTCCCATCCCGCTGCTTCGCTG
TCCCAACTGTAAGGACGCCACCACTGCCTCCACCGCTACTACATCCACCA
GTTCCACCGGGAACGTGAGTACCTGTAGCGTGCTTAATGCCGTTTGAAGC
GATGTCGGCTTCAGTTGCGGGTTTGGAAACCGATAACGACGACGATGGCG
AGCAGCAACAGCAGCCGCGAGAGACGCTGCTGCAGGAAAAGGAAAGGGTT
TCGTTGGACACGCTTCCGGACGAAATCATTCTTACGGTTTGTGAATTCTT
GGATGTGCCGGAGTTGGGGGCTCTGGGGAAGACAACCCACCGCCTCCGCG
CCCTATCCACGGACCCCCTCCTACACAAGATCCGGCTCCACCGCGCCAAA
GCGACTCTTGCAGCCTCCCTCCAACACCGCCCCTCCCTCCCGCTCCTCCG
CGACGCGCAAATATACCTGACCCGCCGCCAGCACACGCAGCGCGTCCTCT
CCCGTGCACTGCTTGGGATCAGGTTGAAGCATCACTTTCTCACCCGGCCG
A

Sequences in the Contig:

SY0AAC20YE01FM1 SY0AAC29YL02FM1