Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3946
Length(NT) : 644
Best Gene Model Blast : Link to GSTUMT00010528001 E-value : 5e-13
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3946
TTGGGTCAACTATGGGTGCGGAGGCGGGGACTGGGGAAAAGGGTATAAAG
AGGGTAGATGACGGAGGCCGTTTTGACACTTTCTTTCCTCTCTCTCACTT
CCAATCTTCCAATCATCCTGCAGTTAAACGTTTTCCTCACTCTTCCTGTT
GTGAAACTTAAAACGCTCTTCCCTTGTTCGACGCCCACAAAGATATATAT
CGTACCCACTTTTTCTCTTCCTCCCGCTCTTTGCTCGGGATTTGCACCGG
CACTGTATACGGTGAAAGTCGGATTGGAATCATCGAGGTACCAAGACACC
CTGAAGGCGTAAAGACCGCATACTCGGCACAGTTGAAATAGGCGTTGAGA
GCCCCGTTGGGAAAATCTACCGAAGTCTATCACGTCTGGGGTACCGATAC
ACTTGCTTGCTCCCCTGCCCTGCGCGCCCTCCCCTCCTCCCCTCGGAGAA
ATTTTGACATTTTTCCCCCTTAAAAGCCTCCATTCCCTCCCCTCTTTCCG
CCGTCATCACCGCCACTGGTCAACGATAAGCAAACCTTCCATCCCCCCCT
TTTCCCCTTGGTTTTCACTTAAATTTCCACTCGATCCTTCCGTCAAATCA
CTTCGCCATGACTATTGCCACTCTACCAATTGAGGACGCTCCCC

Sequences in the Contig:

SY0AAC20YC18FM1 SY0AAD38YM21FM1