Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3945
Length(NT) : 1025
Best Gene Model Blast : Link to GSTUMT00010603001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_01035
Accession: ref|XP_001560203.1| Score: 123 E_value: 7e-09
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g641 Score: 148 E_value: 4e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3945
TGTACAAAAAGTTGGCATACTTGTCACAGGGTTGGGCCTTAAGAGAACTA
GTGGCTACCTCAAGAAGCATAGCGGCGGGCAGAGTTTGCCCAGAATTAAC
GGTACTCAGGTGTGCCTTAAGGTGGGGGACACCCATACGGGAGCTGGGGG
TTTTTCACTGAGGGAACAGTGTTTTGTGGAGTTTTTTGTATGTGGCCACC
GAGCGCTATTGCACATTTGGGAAGGTTAGTGTCGTTGCTCTGGCGATGAG
GACAGTTCGAGCTTCGGCCGTCGTAGCAGACCCTCCTATTATTCTAAGCC
TCCTAGTGTCGATATCGAAGGGATGGTTCCAAGATTGAAGTCGGTCAGTT
CGTGAAGTCTCACATCCAACTTCCGCGATCAGTAAGGGACCGGACAGAGT
CTCTGACAGCCGAGGCCGCCACCTCGCATATAGTTAGCTCGATGCACAGG
ACTCGGCGGCCCACGCCTCCAATTCTCGCCCATCTACTCGAAGAATCGGA
GTGAGCGCGAGCTGACCATTCCCTCGAACTGGACTAACATTGCAAGGTCG
GGTATCGATTCCGACGTGTTTTTCACTGCGGTAATGCCGGGGCCGTACGC
GCTGTGCTTGAGTTCGTTAACCAAGCTGTGGAAACGGTTGGGCGGCAATT
GGGTGCTTGGCCAGGATAGTGGGAAGCAGGGTGTTAACAATGTGCTTGAT
GTGGGGGGTAGGGGCGCTCAGGTATTTGCTTGGCAGAGCTTTGTGGAAGC
GGAAGAGGAGAGAGGGAAGGATGAGCTTTTGGGAAGAACAGGGAAGCCGC
CACCTGGCCCTGGTAGGAAGGCACTGCAGGCCACGAGGGAGGGGAGTAGC
TTGCGGGCACTTGTTGAGGCACTTGGACGATACTCTGTTTATTCCGCGAG
TGCTGGATATCTATTTCGAAAACCTATACTATATGCTAGGCACCCCAATG
GAGAAGGATAAGGCTTCGCCGAGAAAACTCTACGTTCTGATCATTGCTAC
CTACAGGATCCTCCCGACAGGCAAG

Sequences in the Contig:

SY0AAC20YC17FM1 SY0AAD35YP24FM1