Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3944
Length(NT) : 1291
Best Gene Model Blast : Link to GSTUMT00007521001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein An18g05750
Accession: ref|XP_001399026.1| Score: 778 E_value: 1e-80
KEGG Definition: hypothetical protein
Accession: ang:An18g05750 Score: 778 E_value: 5e-81
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3154 Score: 685 E_value: 1e-72
PFAM Definition: DUF367, Domain of unknown function (DUF367)..
Pfam Number: pfam04034 Score: 455 E_value: 6e-46
Swissprot: Q12094|YO006_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0042802 = Molecular function: identical protein binding

Sequence:
>Contig3944
TTGGGTACCTTTCGCTCTTCGACCCCCCTCTCCCCCACGCAAAAACACGT
GCACGCACACACAACCTTTCTAGTCTCCATCTCCTCAATCGCCCCAAGCA
AACATGGCTAAGAAGAAGGGCCAACGATACCAGGGACGCGAGCGCCGCGA
GAATCGTGGACAGGGAGAGCGGGAAACCCAAAAGCTTCCATTCAAAGCTC
GTTGTTGGGATCTCGGCCACTGCGACCGAAAGAGATGTTCGGGGCAAAAA
TTAATGCGAGAGGGCTTGATTCGATCTATGCCTCTTGACAAAAAGTTTAA
TGGTGTTGTCATCACGCCTGTTGGTAAAACAGTAGTATCTCCAGCCGACA
AAGAACTCATGGAGAAGTATGGTGCGGCGGTGGTCGAATGTTCATGGGCC
CGGCTAGCAGACGTTCCCTTCCACAAAATCGGTGGGAAATGCGAACGGCT
ACTACCGTACCTTATCGCCGCCAACACCGTCAACTATGGGAAACCGTGGA
GGCTGAATTGCGCGGAAGCGCTTGCTGCTTGCTTTGTTATCGGGGGTCAT
ACCGATTGGGCCGAACAGATTTTGGAACCATTCCCCTACGGGGGGAGCTT
CCTGGAAATCAATGGAGAGCTCTTGGAGAAGTATGCCGCGTGCGCTGACG
CCAACGACGTCAAGAGCGCTGAGGCCGAGTGGTTGGACAAACTCGACAAG
GAATACAAAGAGAGCCGTGAAGGAGGCGAAGATCCTTGGATGGGAGGCAA
TTCCAATCTCGCTTCCGTGTCCGCCCCCGGTAGCCGGGAGGCCACTGAAG
AACCCATGGAATCTCAAAGCAGGTCGTATGAGATGCCTTCCTCGAGTGAG
GAAGACGGGGAGAGATATCACGAGTACTTGAGGCAAAAGGCTTTACAGTC
GAGAGAATTCACCAATCCTAAACCCACAAAGGTCATAAAGGCGAGCAAGG
TGGATTCTGATTCCGATGAGGCCGCCTATAGCGGTGAAGAGGATGATCTT
GATCGGGATAAAAGCATTTTTAACTCAGCCAGAGTCGGTGAGGACAAAGA
GCCTTCCATCAAACATTCGAGCCAGAAGTATCCCAGAACTTATACGGCAT
TCTTGTCTTCAAAGAATATTTCAGCATCTGGAGGGCAAAGTGCATGATGG
AACAAAATGATGAAATTCCAATTTCCTTGGTCGGTTTTAAAAATATCAAA
AAGCTGTACGATAAGGGTAGTTGTCTGATTGTTTTCTCATGGCGCTCGAA
CATTTGTATATTCAATCCATAAAGTCAACGGGTATGATATT

Sequences in the Contig:

SY0AAA17YI04FM1 SY0AAA27YD20FM1 SY0AAB13YK03FM1
SY0AAB24YM23FM1 SY0AAC20YC14FM1 SY0AAC20YC14RM1
SY0AAC20YD06RM1 SY0AAC29YB24FM1 SY0AAC30YP23FM1
SY0AAC46YH05FM1 SY0AAD39YA10FM1