Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3942
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00004251001 E-value : 1e-153
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0670 Score: 192 E_value: 8e-16
PFAM Definition: DUF1777, Protein of unknown function (DUF1777). This is a family of eukaryotic proteins of unknown function. Some of the proteins in this family are putative nucleic acid binding proteins..
Pfam Number: pfam08648 Score: 147 E_value: 1e-10

Sequence:
>Contig3942
TTGGCGAACACCCACGATATCAGCGTTTTGATCATCCACAGCCTTACGCC
CTTCTAACAGTCATAGGGATATCCTATTTTCTCCTTCGACAACTCTGTTC
ACTTTTGGTTTCTGCCGGACTGATATTCTATCCGAATATTCATAAGAAAG
GCTCCCCATACCCAGCGTTTCTCCCAAAGTTTCGAGCAGAACAAAGAAAA
AAAGAAAATATAAAAAAAAGGCAAGATGTCTGGTCTAGACGTAGAAGCCC
TTCTCGAAGCCTCCGAAGGGACTAAGCCAAGACAGCAACCTGATCGTCAC
GATAGTGCTGCTTCTACTCCGAGGCCCGACCGCAACGGCGGCGGGAGCGT
TAAATCTTCTTCTTCTAGAAGGGACCGAGACGGCGAACGAGACAGAGACC
GCGATAGAGACGACAGAAGCCCGCGTAGTGAACGCCATCGTGAACGCAGG
AGAAGCAGAAGCAGGGATAGCGATAGACGCCGTTTAGGTCGTAGAGATTC
CTACTATGATGGTGATGAATACTATGAGTCTTCATCTCGATACAGCAGGC
ACCGCTCCTGCGAAAGGGATGATGACAGGTATTACTCTGGACGCGGTCGA
GATCGCAGATATAGGGATTACTACGACGAGCGTGACAGAGATGATTATTA
CAGAGGAGATAGGCGTGACCGTGATCGAAGA

Sequences in the Contig:

SY0AAC20YB23FM1 SY0AAC22YI16FM1 SY0AAC60YB21FM1