Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3941
Length(NT) : 651
Best Gene Model Blast : Link to GSTUMT00006716001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An08g08550
Accession: ref|XP_001392968.1| Score: 774 E_value: 1e-80
KEGG Definition: hypothetical protein
Accession: ang:An08g08550 Score: 774 E_value: 5e-81
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG0355 Score: 648 E_value: 1e-68
PFAM Definition: No Hit Found
Swissprot: Q9Y8G8|TOP2_PENCH

Sequence:
>Contig3941
TTGGGCTAACTACTAGAGCTGGTGCGTTTGGTAGCAAATGTGCATTGAGC
GACACGTTCATTAAAAATATTTTGAAGAATACTCCAGTTATCTCGAACAT
CATCGACTATGCCAATATGAAGGCTGATAAACAATTGAAAAAAACGGATG
GGTCGAGACGCTCTAGAATCAATAATCCGAAACTTATCGATGCCAATAGA
GCTGGAACCAAGGACTCCCAAGAATGCGTGCTTATTCTGACTGAAGGAGA
TTCAGCCAGATCACTTGCTGTTGCTGGTATATCTGCAATCGATGGGCGGG
ACAGGTTTGGCGTTTTCCCCTTGCGCGGAAAACTTCTTAATGTTCGAGAC
GCCTCTCATGACCAAATAATGAAGAATGCGGAAATTCAAAACATTAAACA
GATTCTGGGGCTGCAACATAAGAAGGTTTACGAATCAAGGAAAGAGTTGA
GATATGGTCATCTCATGATCATGACGGATCAGGATTATGACGGAAGTCAT
ATCAAAGGATTACTTATCAACTTCTTCGAGACTCAATTCCCTAGTTTGCT
CAAGTTGCCCAACTTTCTGATCGAATTTATCACACCTATTGTGAAGGTGT
TCAAGGGTGGTGTCAAAAAGCCAACAAAGGAGATTAGTTTCTTTACCATG
C

Sequences in the Contig:

SY0AAC20YB19FM1 SY0AAC26YO09FM1