Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3940
Length(NT) : 1737
Best Gene Model Blast : Link to GSTUMT00010084001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001216736.1| Score: 1710 E_value: 0.0
KEGG Definition: beta-N-hexosaminidase, putative [EC:3.2.1.52]; K01207 beta-N-acetylhexosaminidase
Accession: afm:AFUA_2G00640 Score: 1683 E_value: 0.0
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_20, Glycosyl hydrolase family 20, catalytic domain. This domain has a TIM barrel fold..
Pfam Number: pfam00728 Score: 307 E_value: 1e-28
Swissprot: P96155|HEX1_VIBFU

Sequence:
>Contig3940
AAGTGGTCAAAAAGTATCACCCGTCAGGGGTAATCTTTCGCCTTATATAC
TTGCAATTTCCGCTGGTGATATTGAACCGCCCGGAGTTTAATACATCCAA
ACACTACACGATGTTTACAACGCGCCGAGGAGAGAAAATATAAGACATCT
ATCACCCCCGCCAACACCACATTCTCAAAGGAGCGAAAGGCAAATCTCTT
GCCGCTCGGGATCATCCAACCAGCCCCTCCCAAATTCTCACCCGGTGTAC
CCCGCCGCGAACCTGCTCCACCGGCGCAACGAAGGCCATCTGACTCCACG
AGAACAGCGTATTCCGACCGCCAAAGATGAATACCTCGAAACGGCCCAGG
AACGTGCCGTTCTGCCACACCCTACTCCCACCGATCCTGTCCGTCTGTAT
GGTTATCGTGGCAATCGGGGGGAGGGACACGGGTATGTGTGTGGATGCGG
TGTCGTTGGACCAGATACGGCCCGGGTGACTGGGGTCGAAAGCGCTTTCC
GCAACGCTGCGGAGGGGGTACTCGAAGCCGTCGGCCGTGAAAATGAGGGT
GGAATCGGGGGTTAGTGTTAGCGAGACGGCATCGTGGGCTGAGGAGAGGG
TGAACGGGGAGGTGTAGGTGATTTGCATGGTGTAATTCATCCCCTTGGAT
TTGGTCGCTAAACGGACACCGAGGGTTCCGGTTGGCCAATCGAATAGTAG
GTCCCCGAGATTGTATCCCCCTCCTAATCTCCTGTCAAGGTTCTGGCCTG
GGGCGTTATTGGTCAGGATGGACTTTGAAATTTCCAGTGTTCCGACGTCA
ATTTCAGGACCGCGATGTCCGCTCCAGCTCCTTGCTCCGACGACAGGAAT
TCCATCCCGAATACAATAATACGCCTCCAATTGCGTCGTGGCGTCTGGGC
CGTTGTCATTCCACGTGGCCATTATGGCACCTTTATTTCTCTTACTCTCG
ATCGGAATCTGCCACTCCGCCGTCGTGTTAAACGGATTATACAGACTGGG
CTCCCACTGCCAGCCATTGACACCACCAAAGTTCAGCACACGCGCCTCGT
TAAAGTATTGCGGATATGGCGCTGGCAAGATTGGCGTGTGGTCGTTCTTC
AACCCAGTATACCCCCACCAATCCTCCGAATTGATGATCTCGTAACCGTC
CCTCTCCAACTGCACGGGGTCTGATTGCCCGTACTGCCAGTGCTGCGTGG
TTATCGCCCTAGAAATCACCGAGGTGTTACTCGGTTCATGAGTGCCCCAT
ATACGCACTTTCTTCCCAGCGGTGGTAAAGATGAACTCAGACATGGTATT
AACAAAGTGGATGTAAACATCCGCCAAGTCGGAATCATACTCGTCTGCGC
CGATGTGCACTTCCTTCGTTTGAAACCAAGGCAGGAACTCGCTCCAGATA
GCCTTCACGGTGGGGATGGTGTCCGGGTGCGTCAAGTTCAGCAAGTCCTT
CTTGTTCGTCAATGCAAGTTCCGGCTTCCACTTCGTTATTGCCAAGGCAT
GCCCGGGTGCTTCTATTTCTGGGATTATGGTGATTCCGCGGGAAGCGCAG
TGCCTTTGTATTGATTCAAATTCCGCCCTACTGTGGGATTCGTTGTGTCT
GGCGACCAGCGGGTGGAGCGCGACGTTGTCCGGGATCAGTGAGAACTGGG
AATAGATGTTTTGCCATGTGCTGTTGCGGCCGCGGTTCAACGGGTAGTTG
TCTGAGGCGTGGTAATGAAATTCGGAGAATTTGAAGA

Sequences in the Contig:

SY0AAA53YC03FM1 SY0AAB41YP22FM1 SY0AAB7YG16FM1
SY0AAC20YB10FM1 SY0AAC20YB10RM1