Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3939
Length(NT) : 969
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3939
TTGGCCCCATCCCCAGTCCCTTCACACTTGTCCTTCTATTTTTCGCACGG
AGTCAAAAGTCAACTGCATCCCGAACCCCACCCCAAACTCTATCGATCAA
GCTTGAACTCACAGTACAGTACATCTCACAAGTGCGACCGCGATAGATTC
CCCATACAATCGAAAAAACACCCGTTGTATGAGGAGACACAACATCCACT
CAGCAGACATATGTACCGTACGTCGCTCCTCTGGTTGTCAATTTCCGAAA
TCGGTTTACTTGAAAATCTGAGGACAAACATCTCAACTTTGATAAACGCT
ATATCCGGATAACTATACCCCTATACCTATCCACTTTTATTTTTATTTCT
CTTTCTCTTCCGGTAATCTCAAAATTCAAGGCAATTCGAGTCACATCGCG
GGTAGTGGTGCTTGGGCAAGGGTTTCTTCGATTGTTAATATCATACCGCG
CGAAGCGAGCCGGTGCAATCGATTGTGGCTTCTTTTCTGGAACCAAGGAT
CGAAAAGGAAGAAAGAAAAAAAAACAAATATCACACCTAATCTGACGAAT
AGGATAATAGCCTAAAGGAAAAAATAGTAGAAGCGGAAAAGAAAATTTTC
TTAACAGAGGAAGGAGAGAGACAGAAGAAAGGAGAAAGTGCGAGCAATAG
CATTACTGCTACCCCTTCAGCAAATTTACTACCTTCTACCGCAACAGCTC
CAACCGTGGCTCCCACCGCTGCATTATACACTTCTGCCCTAGCCACAGCC
TCATCTGGCGGTGGAGCGGATTACGATCCCATATCTCCCAGCAGCCTCTT
TGGTCCGTGGGTGGAACTTGGTGCAACACCCACAAACTCACTCAACCCAT
TTTTCGACCCCCGGCCGAGTCCCATTTCTCACCCCCACCATCCTCCTTCC
TCTGACCCCCCATATCGCCCTTCTCACCCTACTCACACTCTTTACAATCC
CCCTTCAGCAAATAGTCGT

Sequences in the Contig:

SY0AAC20YB05FM1 SY0AAC36YN05FM1 SY0AAC60YH10FM1