Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3938
Length(NT) : 1127
Best Gene Model Blast : Link to GSTUMT00003351001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_02009
Accession: ref|XP_001597813.1| Score: 1110 E_value: 1e-119
KEGG Definition: hypothetical protein
Accession: ncr:NCU09545.1 Score: 1087 E_value: 1e-117
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0564 Score: 881 E_value: 3e-95
PFAM Definition: MTHFR, Methylenetetrahydrofolate reductase. This family includes the 5,10-methylenetetrahydrofolate reductase EC:1.7.99.5 from bacteria and methylenetetrahydrofolate reductase EC: 1.5.1.20 from eukaryotes. The structure for this domain is known to be a TIM barrel..
Pfam Number: pfam02219 Score: 852 E_value: 6e-92
Swissprot: O74927|MTHR2_SCHPO
Gene Ontology:
GO:0004489 = Molecular function: methylenetetrahydrofolate reductase (NADPH) activity
GO:0006555 = Biological process: methionine metabolic process

Sequence:
>Contig3938
TTGGCCGACGCAAGATACCCGGTATCCCACGCCTCGCCCTTCCTCTCTCC
ACAGCAAGCCTTCACTTCACCTTTCGAGGTATCATAATTGACAACAAACA
AACAACGGAACAATGGACAAAGTTGTGAACAAGATTGCTGCCCTCCCACC
GGGTGAGCCGTATCATAGTCTTGAGTTTTTTCCGCCAAAGACTTCAATGG
GGTTTCAAAACCTACAAGCCCGTCTGGAGCGCATGGCTCGTGCTCTCCGG
CCTCTATTCGTTAACGTTACCTGGGGAGCTGGAGGCTCAACCGCCACCAA
ATCCCTTCAGCTTGCCGAGATCTGTCAACGCCAGCTCGGCCTCACCACAG
TGCTACATCTGACATGCACGAACACGTCACAAACCGTTCTGGACGAAACA
TTGGAAACGGCAAAGGAGATTGGGATTCGCAACATTCTTGCTTTGCGGGG
TGATCCACCAAGAAGCGATGATTATCATAACACTCCGTGTGACGGGACTT
CCAACGGCGCCGGGAAGGAGTTCGGGTATGTCATTGATTTGGTCAGATAC
ATACGGGAGAAGTACGGTGATTATTTCTGCATAGGAGTGGCTGCTTACCC
TGAGGGTCATGTTGAGGGAGCTAGCCCTGAGAAACAGGATCCGTTGTTTG
ATCTATCATTCTTGGTTGAGAAGGTTAAGGCTGGCGCAGACTTCATAATG
ACTCAATTGTTCTACGATGCGGACAAGTATATCTGGTTTGAGAAGCTGCT
AAGGGAGGAACCTTCGGGGGTGCTTTCCGAACTTCCGGTAGTTCCGGGAT
TGATGCCCATACAGAGTTATTCGATGCTGAAACGGATTACCAAGCTTAGT
GGAGCTTCCTTACCCGCATATATTCTACGAAGGTTGGACGATGTCAAAGG
AGATGATGAAGCGGTCAAGCGGGTGGGAATTGATATAGTCTCGGAAGTCA
TCGAGAAGATTAAGGCTGCGAACCTGAGCGGCCCAAGAGGGTTCCACTTC
TACACATTGAATCTTGAGAAAGCTGTATCCTTTATTGTTGAGCGAACCAA
CCTTATCCCACCGCTCCATGAGTCCGTCCTCGAGGAAATTGAGGGCCCGG
ATATGAACGGAGCGGCTCTGAGAAGGG

Sequences in the Contig:

SY0AAC20YB01FM1 SY0AAD51YE20FM1 SY0AAD7YK22FM1