Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3937
Length(NT) : 1642
Best Gene Model Blast : Link to GSTUMT00002717001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_12378
Accession: ref|XP_001802601.1| Score: 589 E_value: 1e-58
KEGG Definition: hypothetical protein
Accession: yli:YALI0B22462g Score: 299 E_value: 2e-25
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4682 Score: 207 E_value: 5e-17
PFAM Definition: BTB, BTB/POZ domain. The BTB (for BR-C, ttk and bab) or POZ (for Pox virus and Zinc finger) domain is present near the N-terminus of a fraction of zinc finger (pfam00096) proteins and in proteins that contain the pfam01344 motif such as Kelch and a family of pox virus proteins. The BTB/POZ domain mediates homomeric dimerisation and in some instances heteromeric dimerisation. The structure of the dimerised PLZF BTB/POZ domain has been solved and consists of a tightly intertwined homodimer. The central scaffolding of the protein is made up of a cluster of alpha-helices flanked by short beta-sheets at both the top and bottom of the molecule. POZ domains from several zinc finger proteins have been shown to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes including N-CoR and SMRT. The POZ or BTB domain is also known as BR-C/Ttk or ZiN.
Pfam Number: pfam00651 Score: 131 E_value: 3e-08
Swissprot: Q96IK5|GMCL1_HUMAN
Gene Ontology:
GO:0016363 = Cellular component: nuclear matrix

Sequence:
>Contig3937
TTGGCCCCATCATCGGCTCCACCCTTCAACCACCCTTCACAATCGATCTT
TAATAATCCCGGCATCGGATCCTCCGCACCTTCTTTGTTGGCCGTCCCAT
ACAGCAACGCCGGTGCTCGCCTCCACTCGTTCACTTCTCGACCTCTGAGT
TATGGTGGTGGAAGTGGGAGTGCTCTGACCGTTGCGAGCTCGAACGTTAA
GGCAACTGCTGTAGCTGGGGGCTCGAGTGGGAGCAATGGCCATGGGGCTG
GTTCTGATCCTGCTGTGAAGGAGGTGGACGATCCGACAACCCCCGTGAGT
CATTTAGACAAGGCTGCTGCGCTGAATACCTTCTCGAGGCTCCTTGCGAC
GCCAGCCTCGCAGACTGCGTTCAGTCGGAGTGGAAGGAATTGTAGCTATC
GAGGTTCTGATTCGGTCAAGTTGGAAGACTTCCTCTACACTCGTGGTTTC
CTGGAAGGGGCTTGCAGTGATGTCACCATCATCACTTTTGGCTCTCGATA
TTGCCTGCATCGACTTATTCTGGACCGATCGCCTTTCTTCTCATCATGTT
TCAACGGCGGGCCTTGGCTAGAATCTACCTCATCGGAGATCTCATTGTCT
CCATCAGATCCTAATATCACTCAACATGCGTTTGAACTTGCCCTAGGAAG
GTTGTACGGTCATGTTGACAGGGTCGAGGAGGACCGTCATGCGCTCCCAT
TATTGGCTGCGGCGAGCTATTTAGATCTCCAGGACCTTGCGGAATCTTGT
GCCAGTTCCTTGCTCAGGAACCTCGGAACAAGTAATATCTCTACCGTCGT
TAGATTTGTCACAAACAGCTATTACGGTCCGCTCACAGATAGACTAATGG
AGAGTGCTAAAGCCATGCTATATCGAGATGGGTGGGAGATGAGCTTTGAG
GAGTGGGAGGGGATCAGTGGCGAGGTTGCGGCTGAGATCATTGGATATGA
TGGGTTTTACGTTCCTAGTGAGTGGTTGAGATACTGCTTCGCGAAGGATA
TGATTGACTGGCGGATTTGCCATTCCTTGTCGTATAATCGTGCAACTCAT
GAGGGTTGTTCTTTGGATGACGAGGATTACGATGCGGATGGAGCTTCGGC
TTTTGACGATGAAGAGACTGACGTTAAGCCCTTGAGAGAACTCTTGGAGA
ATGGCATCTACTATATCCATATGTCTTTCGAGGAGTTACAAAAGATAGAA
ATGGACCGAGATGTTCTCGGAAGAAGGACGGTTGCTCAGGACACTATCAG
AGAAGCACTCTGGAACCAGATGCAATTGAGGCAGAAAGTTATGAATGTTC
CATTGAATAGTCCTGATCTTGGCATTACCGAGACGGAGACCGTGCGCCAA
CCCACTCCTCTAGGGAGAAAGAGTTCTCAGAGATTGCCGACTCCAAGGTT
TGGCGAGAAGCTGGGCGAACCTGGATCCGGGCGCGCAACTCCAACGCGAC
AAGATGATGGAGATGATGGGCCTGACGGGCCTGATACGCCAACTACCATA
CGCGGGCGCCAGACTAAGCGCAAGTATTATATTCCTACCGAGGATACGAC
CACGGTTATTGGAGATTGTCAAGATACTCCTCAACACCTTGCTGTTTCTC
ATCCAGTGCATCGAGCTTCTGCTTCTAGGGCTTCTGAATGCC

Sequences in the Contig:

SY0AAA21YG08FM1 SY0AAC20YA16FM1 SY0AAC7YK19FM1
SY0AAD12YI04FM1 SY0AAD15YJ09FM1 SY0AAD45YD16FM1