Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3936
Length(NT) : 944
Best Gene Model Blast : Link to GSTUMT00005251001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_02685
Accession: ref|XP_001248914.1| Score: 574 E_value: 3e-57
KEGG Definition: hypothetical protein
Accession: ang:An15g00950 Score: 547 E_value: 2e-54
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0978 Score: 174 E_value: 2e-13
PFAM Definition: BRE1, BRE1 E3 ubiquitin ligase. BRE1 is an E3 ubiquitin ligase that has been shown to act as a transcriptional activator through direct activator interactions..
Pfam Number: pfam08647 Score: 225 E_value: 2e-19
Swissprot: Q4WDD7|BRE1_ASPFU

Sequence:
>Contig3936
TTGGCAATTACAAGCCGATAACACTCGACTCTCGGAACAAGTAACGACTT
TTACGATCAAGTTCGGAAGGCTGTCGGAAGAAGATATATCCAAATGCGAT
GCCTATAAAAACCTGAGGGTCAAGCTCGAAGATTTAGCTACCCGGTTCAA
CCATATCGAGGCTCTCAACAGAGAGCTGTTAGAAAGAACCGAACATTTTG
AAGCTGAACGCACGAAATATAAGGAGTTGATTCTCACTGAACAGCATACT
GTAATAAGTGATATGCAACTCCAATTGAGCAGGACAGAACAAGACCTTGC
CCGTGTGCGAGCCGCTCGAGATGAGCTCATCCAAGACCAGACTCAACGCA
AAACAAGAGAAGATCAGAAACTTGGGTCGATTAGAGAGGTTAACGAACTG
GCTGAAACAAGGGCTTCCAGAATTGCCTCGCTGGAAATGGAGGTTGAACG
GTTGAGACTCGAGCTTGACAAGGAAGCCCTCTCAGACACTCAACCTTTCG
CAGAATGGGGCCTAGACGAGCTCAGGCAGAAGTATGAGCACCTCGACAAA
GCTTATAAAGTTCTGACCCAGGAATTACCCGCGTTAGAGCAAGCTTTCAA
GAAGGCTCATGATCAAGCATCCAGAAAGGTTGCAGGGATCCAGGAGAGTG
AGGATAAGATGCGACGCTTGCAGGCCGAAAAAGGAAAAGCCGATCAAAAG
TACTTTTCAGCAATGAAGAATAAAGAGACATTGAGCGCTGAGAACCGAGC
CCTGAAGAACCTGAATGCTAGGAGCACGGATATTATCACTCAACTCAAGG
ACGCTGAAAAGAAGGTTCGCGATCTAGTGATCGCCGAAATGAAAACTGTT
CAACAGACCTTAATTACGAGGAATCGTGAGCATCAGTCTCGTGTGGCAGA
ACAAAACAATACTACTGATTCCCTGAAGTCTCAAGTAGCCGAAC

Sequences in the Contig:

SY0AAC20YA12FM1 SY0AAD56YP05FM1