Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3935
Length(NT) : 651
Best Gene Model Blast : Link to GSTUMT00008771001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: pre-rRNA processing protein Esf1, putative
Accession: ref|XP_001260166.1| Score: 376 E_value: 1e-34
KEGG Definition: uncharacterized conserved protein
Accession: aor:AO090001000653 Score: 368 E_value: 6e-34
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2318 Score: 435 E_value: 5e-44
PFAM Definition: No Hit Found
Swissprot: Q756J5|ESF1_ASHGO

Sequence:
>Contig3935
TTGGGTCTCCCCACAATAACATTCCCTGCAAGTCCGATTATCGCCAATTG
ATTTTTTCAAACTTAGATGGCTAAAGACAAACATCGGAAGAAGTTCTCTG
ATGAGCCAAAAGTTCCTGTGACAACCGACGAGCGATTCATCTCAGTCCAT
AATGACCCCCGCTTCGCCCTCCCCCGCCGCAAAGATGCAAAACTCAAGAT
CGACAAGCGCTTCGAGCGCATGTACAAGGATAGGTCGTTTGCGGAGAAAG
CAAGCGTAGACAGATATGGTCGCAATATTGGAAAAGACGCAGGGAAGGAG
GAAATCAAACGGTACTACCACATCTCCGACGAGGAAGATGAGGATGAAGA
GCAAGCACGAGTATACGACCCAGCAAGAGGCGAAGGTGTAATTTCCACTT
CGGAAGAATCTAGTGATGAGGAAGACGAAGAAGTCGGAGAGGCGGAAGAG
GAAGCGGCAAGAGCTCAGGTGGAATGTCAGAGGGAGATCCCCATGGGAGA
GGTTAGCAAGAGGTTTGCGGCCGTGAATTTAGACTGGGATAATGTTCAGG
CAGTGGATCTTTTAAAGACCTTCTCGAGCTTTGTTACCGGGGGTGGAAGG
ATTGTTAGTGTTACAGTTTATCCAAGTGAGTTTGGTAAAGAGCGAATGGA
A

Sequences in the Contig:

SY0AAB55YD02FM1 SY0AAC20YA10FM1