Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3934
Length(NT) : 1239
Best Gene Model Blast : Link to GSTUMT00007080001 E-value : 1e-114
Numbers of ESTs : 3

Blast Results:

Nr Definition: mitochondrial dicarboxylate carrier protein
Accession: ref|XP_750662.2| Score: 167 E_value: 7e-10
KEGG Definition: mitochondrial dicarboxylate carrier protein, putative
Accession: afm:AFUA_6G07710 Score: 167 E_value: 3e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P0C582|M2OM_NEUCR

Sequence:
>Contig3934
TTGGGGTCATCTTACGTAACCCTCCTAACCCGAGTCATTCTCGCCTCGCT
CGGAGGGAAAGAATCTACCTCGGAACAAGGCTGGCTATCTTAATACCATT
ATCTACGGTTAACTTACCACCGTAGGGATGGGGGAGGGAGAGACCGGGGA
AAAGAGTCTTTTTTTTGTTGGGAGTGGGAAGGAAAGGGTTGGATGGATGG
GTGAAGGGAGCGCATACTCCCACTAGTTGCTGAATTGCTATCTGCTCGCT
GTAGGTTATTCCGGTAATAATAAAAAATGAATTAACAAACATAGCCGCTG
CTGGTGTGATGGGCGCGGAGGTCCGGCACATGAGTGATAACTTAGGGATG
GAGGGAGAGGCATTATCATTTGGTGTTGGAATGAATTGTCTACCGGTACC
GGGTGTGGAGCTTCGAAATGTGAGGGGGATTGTGGAAGCGATATTAATGA
TTGCTGTCAAGATTGACGGATCCGGAGCACCTACACATGACCTGTGCTAC
GCACCCCGGCGGGAGCGAAAGCGCAAAACTCAAGATACCCCTCATTTTTT
TTTGCTCTATTCTATCATCTATCCTGTGCCTGTCGCTTCTCTTTTCTTCC
TCACTTATTACCCTCCTCCTCTTTTCCTCCTCACCTCCCCCCCTCTACTC
ACCCCACCACTCTCCCAACGTCCTGGTTCTGACCTTTCCAACCCCGGTCT
ATTTTCTCCTTTCAAAGCTACGGTAGAATCATGTCGGCAGCAGCAGCGGC
ACCAGGCCGTTCCGTCGGTCGCGGTGGCAAATCAGACTTCTTGCACCACC
CCATTACTCGCAGTGTACTTCCCTTCCTGAACGGGGGAGCAGCAGGAATG
ATCGCAACGAGTGTTATTCAGCCGGTAGACATGGTCAAGGTGTGTTTTCC
CGCCTCTCGGAAAGGTTTGCTGGTTGGCGGGAGGGCGGAACTTTTCATGA
GCTTTAGCTCTTCAGCTCGATTAAGCTCCCGCTCAAATATAACCCTAACC
CTATACCAATTCTCAATCAACGCAAACCCCGAATTCCGAATATCATATCG
GGAAACGATTAAATAAACCCCTTCTGACATGGAATTCCGTAGGTCCGTAT
TCAATTAGCTGGCGAAGGTGTTCGCAAGGACGCCATCCGACCCTCTGCTT
TCAAAGTAGCCGGTGACATAATCAAGCAAGGCAAATTCCTTGATCTCTAC
AGCGGTCTCTCCGCTGGTCTTCTCCGTCAAGCAGTATAT

Sequences in the Contig:

SY0AAC1YP24FM1 SY0AAC2YM04FM1 SY0AAC45YP21FM1