Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3933
Length(NT) : 1490
Best Gene Model Blast : Link to GSTUMT00009854001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein An07g03000
Accession: ref|XP_001391383.1| Score: 1283 E_value: 1e-139
KEGG Definition: hypothetical protein
Accession: ang:An07g03000 Score: 1283 E_value: 1e-139
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0955 Score: 731 E_value: 8e-78
PFAM Definition: PHD, PHD-finger. PHD folds into an interleaved type of Zn-finger chelating 2 Zn ions in a similar manner to that of the RING and FYVE domains. Several PHD fingers have been identified as binding modules of methylated histone H3..
Pfam Number: pfam00628 Score: 123 E_value: 3e-07
Swissprot: Q9ULD4|BRPF3_HUMAN

Sequence:
>Contig3933
TTGGGTGTTATTTGCGATGATGGCGAGTGTGAAAATTCTAACGCCATCGT
CTTCTGTGACGGGTGTAATTTAGCAGTTCACCAAGAGTGCTACGGGGTGC
CACATATCCCGGAAGGTCAGTGGCTTTGCCGCAAATGCTTGGCTATACCT
AATAAGACAGCGAACTGCATATTCTGCCCAAACACGGACGGGGCCTTCAA
GCAGACAACTAACACTAAATGGGCACATTTACTGTGCGCGATATGGATTC
CTGAGGTCATTCTTGGTAACACATCGTATATGGAGCCAGTTGATGGAATG
GACTCGGTGCCAAAATCAAGATGGAAGCTGAGCTGTTACATCTGTAAACA
AAAAATGGGAGCTTGTATCCAATGCAGCAATAAGAATTGCTTTATTGCAT
TTCATGTCACTTGTGGCCGTAGGGCGAGGCTTTCCATGAAGATGAAGAAT
AGCTTGGGGACGGGAGCACTCATGGAAACTTCGGCTCTCAAGGCATATTG
TGATAAGCATGTGCCTGAGCAATGGAGGAGAGACAACGACGTGGATACTG
CTGTGTCCGACGCGATGGACTTTTATGCGAATACGATGACTGGCACGCAG
TGGGGCGATAGCCAGTCTGCTGCGATGGCTGGGCCTGATCACGGCCTACG
CAACGGCATGTTACGAAATGGAAACCTTCCACGGGTTACTTTAACATTTG
GGAACAAACGTAAACGCAGTCAAGACCCCAAATCGACGTGGAAACTTGCC
TCCGGTGCTCCAGTTATACCCCGAGTGATCTACGACCGGGTAGTCAAATT
CGTTTGCCGGTTTGACGTTGCTGAAGTCGATGAATTTGTGGCAAGTGCTT
GTAAATACTGGACTCTGAAACGTGAATCCCGGCGCGGCGCAAGCCTTGTG
AGGAGCCTTCAAGCTTCAATCAACAGCTTTACATCTGCGGAGGTAGTCAA
AAAAAAGTATTCTAGTGCAGGGTTCAAGCAAGGCACAATAGATCTCGAGA
AACGTAAAGAATTTGCTCAGGGTCGTGTTTCTGAGCTGGAGCGTTTGAGG
GAAATATTTGAGCAAAAGCAAGAGAAGGAGAACAGGGGCACTGAAACGGT
GGATTTCATGGAGGCGTATACGGACTTGAACTACTTTCCTGAGATTCCAC
TCATCAGGGATGTCTTTGAAATTGCTAGGAGCCTCGATCCGAATCACGTT
TTCATCAATGGATTTTCACTGATTGAAGAGCGAATAGAAAATCGCTTGTA
TCCTAATGTGGGTGCATTTGCGTGCGATCTCTTGTCTGTTCTTAAATCAC
CGCCTTCGCAACCGATCCTGGAATACAAGGTTGTTTACCGGTATCAATTG
GGATCAGGGTTGATGCACTCATCACCAAAAGACGATTTACAGGGTACAAC
AGTCGCATCGCTGATTTTACCACACGTCCTCCCACTTCTAGAAGATGTGA
GAAGGTCCGAACTAGAGATACGAACTCGTCCCCCCTCTAT

Sequences in the Contig:

SY0AAA12YI24FM1 SY0AAA39YC18FM1 SY0AAC1YP21FM1
SY0AAD19YP16FM1