Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3932
Length(NT) : 686
Best Gene Model Blast : Link to GSTUMT00010508001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_11976
Accession: ref|XP_001586947.1| Score: 433 E_value: 3e-65
KEGG Definition: hypothetical protein
Accession: ncr:NCU02287.1 Score: 430 E_value: 7e-63
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0137 Score: 155 E_value: 2e-11
PFAM Definition: No Hit Found
Swissprot: Q9H845|ACAD9_HUMAN

Sequence:
>Contig3932
TTGGGACACTTATGGTGACCTCATTCCTTTTGGCGACCCTGCTTGGTACC
AGGGTGTAGGTTATTCTTGATCCTCGGGATTGAATTGTTCGAGACCTGTG
GCTGACGGAGATTGGCTAGTATCATTCACCTTACTACAATGCGTCGCATG
CTGCCCTCAGGGACGAGGTTAGGGCGTGGGTTGAGGAGAAGATTGAGCCC
CACTTGAATGATTGGGAGAAGCAGAAGTTCGTTCCTGTCGAGATTTACAA
GGAGATGGGTACTCGCGGTTATCTTCCGGGGTGTGTTCGCTACTGTTGCC
CTTACTCTTGTATTCGGTTAGTCACGCTGACCGTTCAATAGTCTGCTTGG
CGTCAAATACCCCAAGGAATATACCCCGTATAGCGTTGCTTCTGTTCCCC
CGGAGAAGTGGGATCACTTCCACGAGTTTATTCTTACCGATGAGCTATCG
CGTACCGGTTCCGGTGGATTTGTATGGAACATGATTGGCGGTTACTCGAT
TGGTCTTCCTCTGGTATTGAAGTTTGGTCGGAAGGAGCTTAAGGACCGAA
TTCTTCCAGGAATGGTTACTGGCGAGAAGAGGATCTGTTTGTGTATCACT
GAACCCGGTGCGGGTAGTGATGTTGCAAACTTGAATTGCGAGGCCAACAA
GACATCAGATGGCAGGCACTACATTGTCAATGGTGA

Sequences in the Contig:

SY0AAC1YP19FM1 SY0AAD57YM08FM1