Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3931
Length(NT) : 1264
Best Gene Model Blast : Link to GSTUMT00005517001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein NCU06672
Accession: ref|XP_960919.1| Score: 908 E_value: 9e-96
KEGG Definition: hypothetical protein
Accession: ncr:NCU06672.1 Score: 908 E_value: 4e-96
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2337 Score: 752 E_value: 3e-80
PFAM Definition: No Hit Found
Swissprot: Q871U2|ATG7_NEUCR

Sequence:
>Contig3931
TTGGCCTCCCCTGTCGTGGACACATACCCCACCATTAATTGTACTCGAGT
ACCTGTTTCTCCCTCTCCCCCTCTACCCCCTCTGCTCCTCAACCTACCCC
TCATTATTTTTTGCCCCCCCTCTCATCTCCTTCAAGAGAAAAGAAACAAC
CTGCGGAGGAAAAAAAACCTTCTGAAAAAAAATGAAGTACGCGCCTTTCT
CCTCGTTGATAGACCTTCAGTTTTACTATTCTCTTGCGAGCCATAAAATC
GATTACGATAAGCTTGATGAGTCGCCCCGGAAGGTCCTTGGCCAATATCT
TCCTCACGATGGCGGGAGAATGCAGGTCCATGGAAATGCCCTCACGTCTG
ACGAGGTTCCGATAACTGCTTGTCGGGCTGAGGGGATGATCAAGAACTAT
AATACTATCGAGGACTTTAGGAAAGTTGAAAAGATTGTTATGATTAAGCG
GTCCGCGCAGACAATCTGGGGTGCGATACTTGACGGTTCAATATACTCTT
GCCCATCGCTCCTCTCATCCTTCCTTATACTATCGTACGCGGATCTCAAA
AGGTACAAGTTCCACCACCTCTTTGCTTTCCCCGCTTTCGCCGCTACTCC
ACAGTGGACATGCAATACCCCAATCGAGCGATTGGACCCCCACCAAACCT
CCTCTCTCGTCGAAGCGATAAATACCTGGCGGTACAGCACTGACTCACGA
CAACACGGGTTCTTCCTGGTTAAGAGGGATGCGGGGACTTGGAAGATTGG
GAGCTTGGGCGACTTTGAGCACTCCTTTTTCGATAAAGATGTGGATGAGG
AGGACCGGTTTGTTGGGTTTGTGGACCCAAGCGACTATCCGGATAATCCT
GGCTGGCCTTTGAGGAACCTGTTGATGCTTGTGAGGAAAAGGTGGGGGTG
GAGGAAGGTTCGGGTGCTTTGTTATAGAGATGCCCATCAAGGACGGCCTG
AACCTAAGAGTTTGGTCATGGTGTGCGAGCTTGAGGCCGAGGAAGGCCTG
GAAGAGCTTAATCTTGGTGATGAGATGCCCAAGGTTGTCGGATGGGAGAA
GAATGACGATAACAAGATTGTTCCCAAGATCGCAAATCTATCTGCTCAGA
TGGATCCGAAAAAGCAAGCGGATATCAACGTCGACTTGAACCTCAAGCTC
ATGAAATGGCGAGTCGCGCCGGAGCTAGACCTCGATGTTATCAGGAATAC
GAGGTGTCTTTTGCTCGGTGCTGGTACGCTCGGTGCATATGTAGCGCGCA
ACTTGCTTAGCTGG

Sequences in the Contig:

SY0AAA23YO18FM1 SY0AAA5YD06FM1 SY0AAA7YO17FM1
SY0AAB33YD21FM1 SY0AAC1YO21FM1 SY0AAC60YI12FM1
SY0AAD36YK03FM1 SY0AAD56YA19FM1 SY0AAD63YI02FM1