Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3930
Length(NT) : 751
Best Gene Model Blast : Link to GSTUMT00009592001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: extracellular lipase
Accession: gb|ABV03820.1| Score: 553 E_value: 5e-55
KEGG Definition: hypothetical protein
Accession: ang:An18g06580 Score: 512 E_value: 2e-50
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG4569 Score: 224 E_value: 2e-19
PFAM Definition: Lipase_3, Lipase (class 3)..
Pfam Number: pfam01764 Score: 270 E_value: 9e-25
Swissprot: O59952|LIP_THELA

Sequence:
>Contig3930
TTGGCCCCCTTCCATCTCCAATGCGGGAACAGACACATCTCACCAACCGC
CGCAACTCGTCTACCACTCCGATATCCCAGAGCCTATTTGACGAGTTCGA
GGAGTTGTCCAGAATTGTAGACATCTCTTACTGTGTTGGCTCACTAAACA
CCGGTGTCGAACGGCCATTTGAATGCCTTTCATACTGCAAGAACTTTCCA
ACGTTTGAACTTAGACAGGTTTGGCGCAGTGACCGGTCTTTTACACTATT
GCACCCCGCTAACTTGTTCAAGTAGACTTGGAATACTGGTGTAACGCTTC
AAGACTCTTGCGGATACGTAGCGCTCTCGCATGCCCCCGCGCTTCCCCGC
ATCATCGTCGCATTTCGGGGAACGTACTCGATCGCAAACGCTATTGCCGA
CCTGTCCTTGACGAAGCAGGAGTATGTCCCATATCCATCTAGAGACCGGC
AAGAAAAATGTGAAGGATGCCGTGTACATTCCGGATTCTACGAGAGTTGG
ACCCAGAGCGAGGCTATTATCGGAGATATTGTGGATGAGCTGGTTAGGGA
GTATCCGGGGTATAAGCTCACGTTGGTCGGACACTCACTTGGGGGTGCTA
TTGCTGCGCTCGCCGGATTGGATTTTAGGGGCAGAGGATATAACCCAATA
GTTACAACATTTGGAGAACCAAAGGTTGGGAATAGTGCCCTTGCTGGTTT
CCTCAATAAGAAATTCACCACTGACACTTACCGCCGGGTCACACACATTC
A

Sequences in the Contig:

SY0AAC1YN14FM1 SY0AAD15YP20FM1 SY0AAD1YG16FM1