Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig393
Length(NT) : 794
Best Gene Model Blast : Link to GSTUMT00006787001 E-value : 1e-180
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_02736
Accession: ref|XP_001793333.1| Score: 129 E_value: 9e-18
KEGG Definition: hypothetical protein [EC:2.7.11.1]; K02178 checkpoint serine/threonine-protein kinase
Accession: mgr:MGG_14329 Score: 110 E_value: 5e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig393
TTGGGGAGGCTTCGTTTTCAGAGATGCATAAGTCACGAGTCGTGATTCGG
AATTGAGGATTTTTTGGGGTGATGCCACGGCTCTTCTGGCGGGATGGATG
ATTGGACTGGCCGGAATGGCAGACATCGGGTATTATCATGTGTGGTATGA
TACTTTGGATAAAGGATCCACTCGAACCTTCGTTTTGGGGCTGCGATGCA
GTGGATCGTTACTGTACGAGGCGAGCCAAAATACCCTCGGTGGATATTAT
GACTGTAGGAGCGTGGGGAGTGGGCGGGGAGGAAAGGCAATGATACTGGC
ACACTAGTGCCGCCGAAAAAGAGAGATATATGGGTAACATGTCAATAACA
AACATTACATTAACACTAGCCAGACGGACGGACAGGTGGAAAATACCCTC
CCGCCGGCACCAGCGCCATCTATTTCCAAACAGGAATAATAAACGACGGA
GAGAACAAAACTAACGCTTCTTCCCAAGGACCCCCTCCATCCTACGAATT
AGATTCCTCAACCCGACCCCCTTCTCGCAATTCGCCTCCAGCCATGGTCT
CCATCTCCTCCCTGCACTTCCTCACGCTCTTGCTGACGGGCATGCAGGTG
CTCTCCTCGTCCTTAATATATTGGAGCGGGTTGAGCAGAACATCAAACAC
AGAGTTCCAGATCTCCGTCTGGCCAGTAACGCTTAAAGGAACCTATGATT
TTGTACTTCTTGGTTCCACCGCCGAGGATGTTGCCGCGATCCGCTGCGGT
CTCAATGTACTTGCCAAAGAGCATGGAGTGGATGATGGCAGCGA

Sequences in the Contig:

SY0AAA22YM24FM1 SY0AAB26YI10FM1