Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3929
Length(NT) : 716
Best Gene Model Blast : Link to GSTUMT00004791001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_05836
Accession: ref|XP_001592914.1| Score: 668 E_value: 2e-68
KEGG Definition: peptide methionine sulfoxide reductase [EC:1.8.4.11]; K07304 peptide-methionine (S)-S-oxide reductase
Accession: aor:AO090120000273 Score: 643 E_value: 9e-66
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1635 Score: 511 E_value: 1e-52
PFAM Definition: PMSR, Peptide methionine sulfoxide reductase. This enzyme repairs damaged proteins. Methionine sulfoxide in proteins is reduced to methionine..
Pfam Number: pfam01625 Score: 523 E_value: 4e-54
Swissprot: Q09859|MSRA_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig3929
TTGGCGACAAACTGGCCATCATCTCAACTGGAATCCTCTCCTTCTTCCTC
CTAACGCTCACGACAACGTTAATGTTCACATCTCTCCTCCCTCGCTTCTT
CCGCCTCTTCTCAGCCAGCAAATTCACCTTGGGTCCTCTCGGCGGCAACA
TGTCCCTCCCGGAGACCACCGAAAAAGCAACATTCGCCGCTGGGTGCTTC
TGGGGTGTCGAACATCTCTTCCGCAAACACTTTACAGGCAAAGGCCTGTT
GGATGCTCGAGTCGGCTACATAGGTGGGGACACCGCACACCCAACCTACC
GTTCCGTTTGTTCCGGGACAACCGGCCTTCTCTATAACCCTTCAGAAGTC
ACCTACGAGAAACTTCTAGAATTCTTCTTCCAGATGCACGACCCAACAAC
GGTGGATCGCCAGGGGCCAGACGTGGGATCCCAGTATCGCTCGGCGATAT
TCTTTCACAATGACAAGCAGGAGGAAGCTGCCAAAGCGGTGCTGGAGAAA
GTTACGAAGCAGTGGTATAAGACCGACATGGCGACTCAGGTGATCCCCGC
TGGGGAGTGGTGGGATGCAGAGGATTATCATCAACTTTATTTGGATAATA
ATCCAGGAGGCTATGAGTGTCCTTCGCACTATCTGCGGACCTTTCCACCG
CTCGCTTGATTGGTTAGGCGCAAGTGTCGAATTGGTGGATAGCTGGGTTA
CGTGAGGTTTAGTGCC

Sequences in the Contig:

SY0AAC1YN12FM1 SY0AAD4YC24FM1