Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3928
Length(NT) : 1910
Best Gene Model Blast : Link to GSTUMT00004657001 E-value : 0.0
Numbers of ESTs : 36

Blast Results:

Nr Definition: hypothetical protein SNOG_07690
Accession: ref|XP_001798022.1| Score: 1776 E_value: 0.0
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG00175.1 Score: 1759 E_value: 0.0
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2617 Score: 1327 E_value: 1e-147
PFAM Definition: Citrate_synt, Citrate synthase..
Pfam Number: pfam00285 Score: 991 E_value: 1e-108
Swissprot: Q9TEM3|PRPC_EMENI
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0050440 = Molecular function: 2-methylcitrate synthase activity
GO:0019679 = Biological process: propionate metabolic process, methylcitrate cycle

Sequence:
>Contig3928
TTGGCCCTGTCCTCGCGGGAAACATTCATACACGAACCCTTTTTCCCCTC
AATTCACCATGTCTACCAGAGCATTGAGTTGCAACCTTGGTGGAATTGCT
TCTCGCATTCGTCTTGTCTACGCTGGCCAACGCAATGCCTCGACTCTGGC
CCAGAAAGACCTTAAGGATACGCTTAAGGAGATTATTCCCGCGAAGCGTG
AAGCGCTGAAGAGGCTTAAGGCAGAGCATGGACAGAAAGTGCTCGGGGAA
GTTAAGGTTGAGAATGCTATTGGTGGGATGAGAGGTATCAAGGGCATGCT
CTGGGAAGGCTCTGTTCTGGATGCCAATGAAGGGATTAGATTCCACGGAA
AGACGATCAAGGACTGTCAGAAGGTCTTGCCTAAGGGGACTTTTGGGGAG
GAGATGCTTCCCGAGGGAATGTTCTGGTTGCTGTTGACTGGACAGGTTCC
TAGTGTCGAGCAGGTCCGTGGGTTGAGCAGGACGTTGGCCGAGAATGCGG
GATTGCCGGATTTTGTTGGGCTGATGTTGGATAATATGCCGACTACCCTA
CATCCTATGACACAATTCGCAATCGCTGTCTCCGCTCTAAACCATAACTC
CAAGTTCGCCAAACTATACGAGAAAGGTTTATCAAAAGCCGACTACTGGG
AGCCCACGTTCGACGACTCCATCTCCCTCCTGGCTAAGCTCCCCACTATT
GCCGCCAAGATTTACCAAAACACCTACCTCGGCGGTGGCCCACTCCCGTC
CCCTGTCGCGACCCAGGATTGGTCATACAACTACGCTGCAATGCTCGGAA
AATCCGATAACACCGGTTTTGTAGACCTCCTGAGACTCTACCTCGCGCTG
CATGGCGACCACGAGGGCGGTAATGTATCCGCGCACGCAACTCACCTCGT
CGGCAGCGCACTTAGTGACCCCTTCCTCTCGTACTCTGCCGGTCTCCAGG
GTCTCGCGGGGCCTCTCCATGGCTTGGCAGCGCAGGAAGTGCTTCGGTTT
ATCCAAGCAATGCGCAAGGTAGTCGGCGACACCTACTCGGACAAGGATAT
CGAAAATTACCTCTGGTCCCTTCTCAACAGTGGGCAGGTGATCCCCGGCT
ACGGCCACGCCGTCCTTCGCAAGCCGGATCCCCGCTTCGAGGCGCTCATG
GGTTTTGCCGAGTCCCGTCCCGAAGTGGCGGAAGGAGCCGTATTTAAACT
CGTCAAGAAGAACAGCGAGATCGCGCCAAGGGTTTTGACGGAGCACGGGA
AGACCAAGAACCCGCATCCGAACGTGGATTCTGCTTCCGGCGTTTTGTTT
CATCATTATGGAATCAACCAAGACCTGTACTACACCGTTACTTTCGGCGT
GTCGAGAGGCTTGGGTCCCCTGGCACAGCTGATCTGGGATCGAGCTCTCG
GCTTGCCGATCGAGAGGCCCAAAAGTCTTTCCATGGAGGCGATTTCCAAG
GCTATTGGCGCTTGATTTCTCTTCTCCGATGTGAGATGATACCTTGTAAG
TTAGGTTGGTTGAAAGTCTAAGAAATAGAACAAAAACAGAAAAAGTATCT
TCATAGAATATCACTGGTATTTCTGATTGTGGTTACGAAAGTCTTGCACG
GTCTAATTTATGGGGTTGGGGGTGCTTGCGTGTTGAGGCGGTTTCCGTCT
TCACTTGTACATCGTTAGACCTACCACGAGGAGCTGTTGGGTCGAAGAAA
TGTCTGTAGCTTTATGTGGCGTTAAGTCTGCTATCATACCCGTACGCATC
ACCGACAGCGGGGTTCCAACTTTGTGCATCACATTCCACCACCACCCGAC
CGAGGGATTCACTCGCGGGGCAACACACACTCTTCACACTGCACGCACCG
CACGCACTATCCCACCATCGAAGGAGCAACACCCCCAGTTAACCCCCGCC
CCGCCCCACC

Sequences in the Contig:

SY0AAA55YN22FM1 SY0AAC13YG11FM1 SY0AAC17YD06RM1
SY0AAC1YM13FM1 SY0AAC20YP19FM1 SY0AAC23YA20FM1
SY0AAC24YM12FM1 SY0AAC25YH23FM1 SY0AAC37YD12FM1
SY0AAC38YD04FM1 SY0AAC46YC07FM1 SY0AAC50YN10FM1
SY0AAC52YJ13FM1 SY0AAC57YF06FM1 SY0AAC5YI13FM1
SY0AAC60YA20FM1 SY0AAC62YE18FM1 SY0AAD15YG16FM1
SY0AAD20YO13FM1 SY0AAD21YI20FM1 SY0AAD22YF10FM1
SY0AAD24YP15FM1 SY0AAD26YA12FM1 SY0AAD27YE05FM1
SY0AAD31YP04FM1 SY0AAD34YD04FM1 SY0AAD47YO07FM1
SY0AAD51YD18FM1 SY0AAD52YL01FM1 SY0AAD56YD17FM1
SY0AAD60YE23FM1 SY0AAD62YE09FM1 SY0AAD8YG10FM1
SY0AAD9YA02FM1 SY0AAD9YI05FM1 SY0AAD9YN24FM1