Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3927
Length(NT) : 593
Best Gene Model Blast : Link to GSTUMT00007394001 E-value : 1e-25
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3927
TTGGATCGGCGAGACCAATGTGGGGGCTTACATGCGGTGGTATACCAGCT
CGTGAAGATTGACGGAACATGGCCTCGAGATAAGAAGGTGGGGAAGGAGG
TATTATAAACATACCTTTTGCGCTGAGAAACGTAATGGCAAGAGCGTCCG
CGGAGCGCAAGAGAGAGTCGGCACAGGGAAAATCGGAAAACAATTGCACA
CAGCACGGCAGAAGGCCTCATTTCGCTTTCGATAAGGAAAAATAGTGCCA
TTGTATTTTTCATGTACCGACAGCGGTACATAGGTTCGACCAATGGGCTT
GATGAGACCTGTCCCTGGTATTCAATCTAACCTCTCCCAGAAAGCAACCC
AATGCAACGCACCACCTGGAATAGCTATTCGATCCCTTACAACGAATGCA
ATCCCGCAATCGAGAAGCATCTGGGTTAAGAGTCAGTGTAACTTGAGTAG
TTCAACTTCTCACATATACTCACTACAGTAAACGCCGAAAACTCGGTACC
TACCGAGTGACTATTAATGCTTCCGATATTAACCTACCCTACCTCAATCG
CAACCGCTCTTAATTGCGCAGAACCAGGGCAATGGGATTTAGT

Sequences in the Contig:

SY0AAC1YM05FM1 SY0AAC34YI11FM1