Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3926
Length(NT) : 2938
Best Gene Model Blast : Link to GSTUMT00012005001 E-value : 0.0
Numbers of ESTs : 45

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE63051.1| Score: 2051 E_value: 0.0
KEGG Definition: mitofusin 1 GTPase, involved in mitochondrila biogenesis
Accession: aor:AO090120000484 Score: 2051 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0448 Score: 764 E_value: 2e-81
PFAM Definition: Dynamin_N, Dynamin family..
Pfam Number: pfam00350 Score: 164 E_value: 1e-11
Swissprot: Q9USY7|FZO1_SCHPO
Gene Ontology:
GO:0005741 = Cellular component: mitochondrial outer membrane

Sequence:
>Contig3926
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCAACGCCTCAGTCTCTCAA
CCCCTCTCAACCCCACTCCACCACACCCCTTCCAATCCAACCTTTCTCGA
CAAACCGTCGACATTGATTGCTGCAACCAACAACTCTTGCTCGCTCTTGA
ACCATGGCGTCTAAATACGCCCAGAACCCGCGTCAAGGCTCTCAGTCTCC
GTCGGCCCTCGCCGCTCACATCGTGAATGACAACGACTCCGGTTACGGTT
CTATCGTGGAAGGTGAAGGAGATCATCCTGCTGTGGTTTTGAATCCGGGA
CAAGCGACCGATGCCGATAAGAGATTGTGGGCTAGCCATGTCATCCAGCT
TCATTACAATCAGAATCGTGTTGCTCTTGGCCGCTCTATCGTCCATGTTA
TAGATACACTCAAGAAATTCCAACACAACAACAGCAAATGGCCAGCCCAT
TACCCATCTGTTCAACGCATGGTAGAGGCACCATCGCTAGCACGTACTCA
ATCATCTGGAGACGAGGGTGCGACGACAACGGAGCCCCGTTTGGTCACCC
CACAGATCGCGCAGGAGTTCAACGTTTTGAAGTTGGATCTTAAGCTTGGG
GCGCTTTCACCATCGGAGCTCGTTCACTCGCTCGAAAAGTCGTCCATTGC
TTCTTTGTTGGATGGAAAGATTTCTCAGTCTATCAAACACCTTTCTGCTC
TTAGGGAGAGAATTGATGATACCGCATCGAAAGTGCTTGTTACTGGTGAT
TTGAATGCTGGAAAATCGACATTCTGCAATGCTCTTCTCCGCAAGAAGGT
TCTCCCCGAGGATCAACAACCCTGCACGAGCATCTTCTGTGAGGTTTTAG
ATGCTAGGGACAATGCTTCGGTTGAGGAGTTCCACGCAATCCCCATTGAT
GGACCAGCATATAACCGCAATGACGAGAGCACATACGATGTTTACCCATT
GGAGAAGTTGGAGGAAATCGTTATCGAGAATGACAAATATTCTCAGGCCA
AGATATATGTGGAGGATGCCCGATCGGTTGATCAGTCTCTTCTCCGCAAT
GGCGTTGTCGATATCGCCCTCATCGACGCCCCCGGTCTCAACCTTGATTC
ACTCAAGACCACTGCCGTTTTTGCTAGACAGGAGGAGATTGATGTTGTTG
TTTTTGTTTTGAGTGCGGAAAATCATTTTACTTTGTCAGCTAAGGAGTTC
ATCTGGGATGCCGCTCGCGAGAAGGCATATATTTTCATTGTCGTCAATCG
TTTCGATAACATTAGGGATAAAGCTAGATGTCAACGGCTCATATTGGAGC
AGGTCGCTAGTCTTTCGCCAAGAACCCACCAGGACGCCAAGGAACTCGTA
CACTTTGTGTCATCCAACGCGGTCATCGACGGAGATGACGCTGCCAAGTG
CCAGGAGTTCGACAAGTTGGAGCAGAGCTTGAGGAGGTTTGTGCTTGAGA
AGAGAGCCAGAAGCAAGTTGGCACCGGCCAAGACCTATCTACTTAATGTT
CTTGAGGATTTGGAAACTCTGGCCGAGGTCAACAAGGAGGCTACCTCAAC
CGAGTTGTCTAAGGTCCGCGATGAGCTCAACAAGATTGCGCCGGAGTTCG
AGAAGTCTGTAACGGTGCGCGTGGAAGTCTCCGAGGGTGTTGACAATTCA
ATTGACGAGACTTGTGCTGCCGTAACCAAGTACGCACGTAAGACCATCGC
CGGCACAATTTCCCGTCTCAGCGAGAGGCCTCCTGTCCAGTATGATGGTA
TTTTTTCAGCCTATGCTTTCGCTGAGGCTACCAAGAATGCCATGCTTGAG
AAGATCCAGGATTCCGTCACTACCTCGGAGGAGTTTGCCAGGACCCAGAC
CACCCAGGGTGTTGCACGAATTGGGTCCATGGGCGTCCTTCATTTGGGTA
GCGAGTATGTCGAGAAAGCGTTCCGCCCCGGGTATATGTTCACTCGCAAG
AAGCATCTTTTGAGCAAGAGCATTAAGACCGAGATTAATGCCTTCGATTT
CTTCGACTTTGATAAGCAAGAGAAGGTTGCAGGAATGAGCTTGAGTCTCA
CGGTCGCTACCGTTGCTGGTGGTCAAGTATTTGGTATCAGCAGCTGGGTC
GACGGATTGTGGAAGGCTACCAGTTTCCTTGGCCCCAAGACTACGAAGAA
ATTGATCGTTCCGGCCATTCTCGTTGCTGGTGTTGCTGGTGCGATCTTCC
TCATCTCCGACATACCCAACGCTGTTCCAAGGAAGTTGGCCAAGAAGATC
ACAAAGGAATTGGAGGAGATGGACTACGTTCACTGCAATTCCGACAGAAT
TACTAAGGAATGTAGGAAGGTTCTTGGGCTCTCGGCTAACGAGCTCAGGG
CTGCATTCCACAAGTCCATCGAGAAGCAAGGCGCCACGATTGATGAGAAG
AGAAGGACCGAGAAGGAGAGTGAGGTCGCATTCAAGTACTTTGGGGGGCT
TCTCAAAGACGCAGCTTCCCAGAAGAAGAGCGTTAAGGGATTGGATTTGG
AGGGACCGGCGATCGTTTTTTAAAAAAACAAAGACAAATACGAATGGAAA
TGCATGCACGGGATCACTAGGGTTTTTTTTTTTCTTTTTTCTACACTCTT
TAATGAGGCGAGTGATTGATTGATTGATTGATTGATTGATGATGAAATAC
AAACCGAACAAAAAAGAGAGATTAGGAAAGGGAGACATTGGGCTTCATTC
TTTTCCTCATCCTCTTTTTCATTTTTCATTGTCGTTTTCCTTTTTTAGTG
TTATCACATTGCATTTTGTCTTTCCTCCTGCTTTACTTGATTACTGGTGT
CGGAGTTGTTTGCAGTCGTCCATCCCGCGTGTCACTTCCCCCCTCTCCCC
ATCAACTGTTATGAAACTTTTTAGTACTAACTACACGACGGTATTTTCTT
ATGTCCAAATTGAGAATATTTTATATACGCTTTCTTCT

Sequences in the Contig:

SY0AAA18YD02FM1 SY0AAA19YB01FM1 SY0AAA1YB05FM1
SY0AAA24YA16FM1 SY0AAA24YA16FM2 SY0AAA24YA16RM1
SY0AAA28YH08FM1 SY0AAA37YG17FM1 SY0AAA40YL14FM1
SY0AAA49YF15FM1 SY0AAA63YM22FM1 SY0AAB11YL04FM1
SY0AAB19YN14FM1 SY0AAB23YI09FM1 SY0AAB23YI19FM1
SY0AAB27YJ03FM1 SY0AAB2YO05FM1 SY0AAB30YC09FM1
SY0AAB32YH06FM1 SY0AAB37YC10FM1 SY0AAB38YE03FM1
SY0AAB45YM11FM1 SY0AAB4YM15FM1 SY0AAB55YG06FM1
SY0AAB55YO20FM1 SY0AAB5YM15FM1 SY0AAC1YM01FM1
SY0AAC20YE03FM1 SY0AAC28YA12FM1 SY0AAC31YP09FM1
SY0AAC32YK02FM1 SY0AAC33YB17FM1 SY0AAC37YE16FM1
SY0AAC39YI11FM1 SY0AAC45YK08FM1 SY0AAC57YN07FM1
SY0AAC62YK13FM1 SY0AAD16YL17FM1 SY0AAD21YL12FM1
SY0AAD23YM16FM1 SY0AAD34YE03FM1 SY0AAD3YL08FM1
SY0AAD42YC24FM1 SY0AAD46YC04FM1 SY0AAD9YK24FM1