Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3925
Length(NT) : 1300
Best Gene Model Blast : Link to GSTUMT00009286001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0670 Score: 142 E_value: 1e-09
PFAM Definition: No Hit Found

Sequence:
>Contig3925
TTGGAGTTTCCGCCTGATTTTGAAGACGAAGAGGAGGAGCAAGCTCCTTT
GGCTCTACCGGCGCCAGGCGATAGTAATGGTAACAGATACTACGGGCCTC
CTCCGCTCCACGGTCCCCTATCGGGAGCCGATTACGCCACCGCCACACCA
ATGGCCAGGAAGAAAACCCAACAGAAATATCCGCCTAACCCACAGGATAT
GAATGATGATGAGTTGGATGCATTTATTGAGAGCGGAAAGGATAAACCTC
CTCCGATGGAAAGACACCGTAAGCCCTATGCATCTAGTACCGGGAATCCT
GGATGGAAAGAAGAACTAAACCCTCGTCCTACTCTCGGTGAAGACAAAGC
ATCCTCGACACGGAACGGCCCTCCACCACCATCTCGCCCGCATACCTCTC
ATGGCCATCATTCATCACGAGATGCTCGAGAGTTCCGAGAAGAACCATAC
GCGAAACCAAGCCCCGATAGAGACCCCCGTGACCCTAGAGATCCGAGAGA
TCCTAGAGACCCAAGGGAGACGCGAGACCCACGGGATTTGTCGGATTTAC
CCGAGGCTCCACTCCGGAGTAAGTCAACCCGTCGTGGCCATCAACGAGAG
CGTTCCGAATATCGCCGCCCTCACCCTCATCGACACTCCCACTCCCACCA
CCGCGGTGGCGGTCGGCGCGACCGATCTCCTGCGGATGAGCATGACCCAG
AGTGGTCTGGGTCGAGTGGGTATCTGCCCAAACCCCCACCAGTGCCCCCG
ACGCTGGTGTCCCCATACCAGGTGCCACTCCCGCCCCACCTCCCCTAGAC
GCTCAAGACCGACGGCCTCGTGCCCAGCGCAAGGCAGATGAAGTTGCCCG
AGTTGCACGTCAGCAGGAGGAGCTTCTCCGCGGGTATGGGCCCCCTGGGC
GCTATGAACCCCCTGCCGATGCATACGAATATGATGAGTTTGCGGGGCCG
CCGCGGGGGCGGGGGGAGAGGGATGATAGGAGGGTGGCCGAGTACGCCTA
TCAGGATGAGTATGACAGGGACCGACGCGCGCAGCCCGGGGGCGGGGCGG
GGGTTGGTAGACGCAGTAGTCATTATGGCGGGGACAGGGGAAGGGCGAGA
GATCGCTCTTCGTACTGGGCCCCATGATGATGATGATCCAAGATTTGGAT
GGGCCATATGGGCAGCGATGGCGGTTGCCGCTTGGTTGTGAGATGATACG
ATGTTGGTTTCTTGTCTTCCCCCTTTCATCTTTCATCACTGGAGGTAAAA
GCTTTTGTGTCGTGGCTCTGGCTCTTGTTTTCCCGGGCCTTTTTCCTATT

Sequences in the Contig:

SY0AAA38YC20FM1 SY0AAC1YL03FM1 SY0AAC58YA20FM1
SY0AAD19YM21FM1