Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3924
Length(NT) : 1032
Best Gene Model Blast : Link to GSTUMT00004459001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: bZIP transcription factor (HacA), putative
Accession: gb|EDP53216.1| Score: 288 E_value: 5e-24
KEGG Definition: bZIP transcription factor HacA
Accession: afm:AFUA_3G04070 Score: 288 E_value: 2e-24
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4005 Score: 116 E_value: 1e-06
PFAM Definition: bZIP_2, Basic region leucine zipper..
Pfam Number: pfam07716 Score: 122 E_value: 2e-07
Swissprot: Q1XGE2|HAC1_ASPOR

Sequence:
>Contig3924
TTGGCGAGCTTCCTATCGCCGAATAATCTCTCATCTCACCCTTCCTTCCC
CCTTACCCTTTCCCCACCCTTTCTTTTCTAACCCACCCCTTTCCCTTCTG
GGCTTTCGCCCCACACTTTCTCACTATCACTCCTCTCTATATCTCCATTG
CGCCTATTCCGGAGACGAGCAATAGGTGCTATTCACCACTTTTACCACCA
CCCGATCGAAATCGAGACACTCTGTCTATCAATCTCGAGTCATCTCACCC
GCTTCACGCACTCTCCGCTTGACTTCTCGCAACCAACACCATGTCGCCCG
CGTCGGTTGACCCTTCGTTACTTTCAACCTTTGACAACCTCCTAGAGCAC
GAGGATTTCTTATTATCGGATAGCGAATCCGTCATCTCACCATTCGATAA
TGAACCTTTCAGTTCTGCAGCATCCAACGCGGGCAGTGATCTCACTTGCC
CGTCAGACACAAACTCTCCTCGGGCGGCGTTTACCCCTGGATGCTCTTCC
TCTCCTCAACCTGAGAAGGTTGAGGAGACGGACAAGAAAACTGCAGCAAA
GCCAGCGAAGAAGAAGCGGAAGTCATGGGGTCAGGAGCTCCCGATTCCTA
CCACAAATCTTCCACCTCGGAAACGAGCCAAGACAGACGAGGAGAAGGAA
CAGCGAAGGATCGAGCGAGTATTGAGAAATCGTGCCGCTGCGCAATCCTC
TCGTGAACGCAAACGGAAAGAAGTTCAGGCTTTGGAGGAGGAGAGGACGA
AGCTAGCCGAGAGCAACGCCCATATGAGGGCTCGGCTTGTAGTTCAGGAG
GAAGCCAACAGAGCATTGTGTCGAGAGCTGGAGGGCATGCAGCAGACGCT
CAAGCATTATGAGGAGTACATGAAGGTGGTGGCTAGTGATATTGCTGCAA
ATGCCATTGTCAGTCCAGCCGACCCGCCCAGCCCGACCTTATATTTTGCG
GCTCCCGAACCGACTATCAAGGAGGAAGAAAATCTGTTTCTATTCCTCGA
TAGCTCAGAGGCAGCCCCAGTCACTACCCTCG

Sequences in the Contig:

SY0AAB54YE18FM1 SY0AAC1YK11FM1