Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3923
Length(NT) : 602
Best Gene Model Blast : Link to GSTUMT00009067001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN6036.2
Accession: ref|XP_663640.1| Score: 152 E_value: 1e-08
KEGG Definition: hypothetical protein
Accession: ani:AN6036.2 Score: 152 E_value: 5e-09
KOG Definition:
Classification: [Extracellular structures].
Kog Number: KOG3546 Score: 145 E_value: 2e-10
PFAM Definition: Cytadhesin_P30, Cytadhesin P30/P32. This family consists of several Mycoplasma species specific Cytadhesin P32 and P30 proteins. P30 has been found to be membrane associated and localised on the tip organelle. It is thought that it is important in cytadherence and virulence..
Pfam Number: pfam07271 Score: 125 E_value: 4e-08

Sequence:
>Contig3923
TTGGCTCGACTCCACCACCACCACTCGCGGTTATAAGTTGTCGACCACAA
GGCATCCATACCTATATTACTCCTGACACTTCTCATTCCAATCTACAAAT
ACCTCGCGGACCATGTATCCGTACGGGCGTAAGACTCTTCTTCATTTGCG
CGTTTCTTTTGCTGACGCTTGATAGAACCTTTCGGCCGACCTACAATGCC
CCCTGGTTTCCCAGGAATTCCCGGAGTCTCTGGGATGGGCATGCCTCCGG
GCTTCGGTATGCCTCCCGGGACTGGTCCTCCGGGCGCACCTGGTCTCCCC
CCCCCTCCTGGTGTTAGCGGTGCCCCTCCGGGGACGGCTCAGGCCAACAT
GCCTACTCGGCCAGGAATGCCAGGATTTGTTCCGCCAGCAAATTTACCGA
ATATTAACTTCAACGCGCCAATTATCAGACTCGGTACTTCTGTGACGCGG
CAAAATCCTGTTCCGTCCTCCTCGAGTGCATCGAAGTCCGGGGCTGGGTC
TTCGCAGGGCTTTTCAAGGGATGCTGCTGCGGATCTAGCACCGCCAAGTG
TAGAGGAGCAACTCAAAACGGTATTTGTTGGTTCTATACCAAAAGACCTG
GA

Sequences in the Contig:

SY0AAA29YF16FM1 SY0AAC19YM01FM1 SY0AAC1YI06FM1