Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3922
Length(NT) : 1450
Best Gene Model Blast : Link to GSTUMT00004843001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_13029
Accession: ref|XP_001803243.1| Score: 808 E_value: 4e-84
KEGG Definition: hypothetical protein
Accession: ncr:NCU08292.1 Score: 746 E_value: 3e-77
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2816 Score: 281 E_value: 1e-25
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 219 E_value: 2e-18
Swissprot: O13714|YDZ7_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0005774 = Cellular component: vacuolar membrane

Sequence:
>Contig3922
TTGGGTCACTATTTTCGTGGGCTTATGGACTCGTCGATTCAGGATCCCTT
GGTCGGATCCGAAGCCGAGGCACAAGAAATACTGGGCGGAAACGGAATTT
CCGAGCCACCTTTGATTGGTGGAGGCCTGAGTGCGGGGGGGGCACTTTAT
CCTCGGGGTCTTCAGCATGAGGGAGCGGAAGCAGGCGAAACATCGCCGTT
GACAGACGAAAACCGAAATGGTGCGCCCCCAAGGGCCGATGAAATTGACG
ATTGGGAGGGAGTTCCATGGTACCGCAAACCGTCTGTTTTTTGGCTGCTG
CCACCGTTTTGCTTGTTCACTATGGCATTTGGCGGTGCTGGTGTACCACG
GCTGAACGTTATCCTAGCTCTTATATGCCAGCAATATTATACAGATACTG
GATATACGGGAAATCCCATCCTACCTGTTCTAATGGGAGGTGACAATGAC
AAACATTGCAAAGAACCCGAGGTTCAAGCTCTTGTCTCGAAGTTCACGTT
ATATATGAGCCTTGTTGCAGGCATTTTTAGTGCGCTTACCTCCCCAAGGC
TAGGGTCTCTATCGGACCGCCACGGAAGAAGACTTGCCATGGCATTTTCT
TCTTTTGGTATGCTTGCGAGTGAAATCACTACTATTTTGGCAGTGAAATA
TCCAGACCTCTTCAGCGTGAATATTCTGCTTTTGGGGTCACTGGTTGATG
GCCTCTGTGGCAGCTTCATGCTAGGGATGGCATTATCGTACTCATATGGG
GCAGACTGCACATCCCCTGCTCGGCGTGCTGTGGCCTTTGGATATTTTCA
AGGATGTCTTTTCCTCGGAATAGCCATCGGGCCAGTGCTTGGGGGTTTAT
TAATCGAAAGGACGAATAACATACTATCCGTGTTTTATTCCGCATTGGGG
GCACATGCTGTTTTTATAGCCTATGTCACGTTTTTCATGCCAGAATCTTT
ATCCGAGCGCCGGATGGTACTTGCGAGGGAAAATCATGAACGCGAGCGGA
TGGAACGGCAAGAGGGAGCCCCTAAACATTGGTGGAACTCTCTTAATCCA
ATAAACTTCCTGCGACCTCTCACAATCCTATTCCCAACCGGGCGGGGTTC
AAGTGCAAGGCTGCGATTGAATTTGATGCTTTTGGCTGCTACTGATTGCG
TCCTCTTTGGGGTCGGAATTGGAAGTATTACTGTGATTCTGATATACGCA
GAAGCAAAGTTTGATTGGGGAAATTTCGAGTCATCCATATATGTTTCTAT
TGTAAACTGCTTTAGGGTCACGATGTTGTTTGTACTGCTTCCCCTGGTGG
TCACCTTCTTTCGTCGTGGATCGACGGCACAAAACCCACTCAAGGGATGC
GATACACTTGATATTAAGTATGGCTGATCTTATGTCACATTTCTACTCAC
CCGAGACTCTTAATCTGATGTGAAACATAGCTTGATCCGGTTCTCGATTG

Sequences in the Contig:

SY0AAA55YO19FM1 SY0AAB56YC23FM1 SY0AAC1YH24FM1
SY0AAC56YK23FM1 SY0AAD41YF05FM1