Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3921
Length(NT) : 1433
Best Gene Model Blast : Link to GSTUMT00002812001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3921
TTGGGTCTTGCGGATGTTCTGTTAGTAATAAATGGGATGGGAGGTTCTAG
CCCAGTTCGACAGTACAATGCACACTCGTTCATCCTAGCAAGATCAAACA
AGTTACACGACTTGCTTCAGATTTCGCTCCAAAAGGTCGATGCTCTAGAA
TCATCGATCGGACATAATCGGGTATCCCCCCAAACCTCTTGGGCTGACGA
GATGGAGCATGGGAATGAGACCCAAGATAGATCCGAATTCAGAAATCATC
GCTTGTTAGACGGTAAACTCACATTGTCGCTCGAGGCTATCGACGAGCCC
GTGAGCGAAGACAGCTTCCTCCTTGCCTTGAGAAGCCTGTATGGTGCTTC
GGATTGGGAACTTGATGCATTCCTCGATCCTACACATCCACAGCATAGAA
CTCTTGAATGGACCCGTGGAAGCTCCAATGCAGTGAAACCGTCTGCCGGC
AATACCGACAACGCTTTATCCGGTAGCAGTGACCACCTAGGTGGCCCAGC
CATGGATGAGGAGGTTAGGATGTTGGAGAGAAGTATTGAGTTATTTGCGG
CAGGTCACTTGTTGGGAATTCCGGGAGTCATTCAAAAAGCAAATTGGGGA
ATTAGAAAGTGGGGGATGCAACTTCAAGGCGGTGCGGTAGAGAGGCTTCT
CGGGTTCATCCTGGAGGAATCGGAGAGTGTAGGAGATGGAAGCGGTGCCT
ATAAGGATCTGAAAAGCCGACTATTTATGGACGTCATTGAGTTCTTGGTT
CAGTCTTTCCCGCTCAACTTCAGGCTAAACCGCAACGCCCCTCCAAGCCA
ACAGCTTTGTCGGTTCCCTAAGGAGCTCAATCAACTCCCGAAAGCAGCTT
TCGAGCCGACCCCGAATCCGGAATCGCAAATAATGGGAATCTACTCCACT
ATTATCTTGAGCGTACCATTCAATATCCTGAAATTGATCGTTGAGCATGA
GAATTTCGGTGTGAGAAACCAGAGCATGAAGAAGCGATATGATGATGCTA
AGGCTATCATCCAAGAGAGGGAGAGGCGTCGCAAATGGTGCTTCCGAGCT
TCTCAACGGCTCTCAACGGAAGACCCTGGCAGCAGGAGCAAGAACGGTAA
TATCTTTTGCTATACGGGTGGGGACGACGGCCAAGGTCCATTTGAAAGTG
TCAAAGGTTGGGATGGGCAAGAAGATTCTCCGATGGAAAACCTGTTTTGG
GAAGAAAGCGCATTTTATGCTATCGGACATGGACAGGGCGGCGGTGGCCG
TGTTGAAATTAACCGTAGAAAGAAGGGCGTTTCGACTGTGAGGGCTCTTT
GGAAGTTGGAAGGTTGAGGATACTGGAGGCGAGTGTTCGGGATAATTTTG
TAGTTGGATTTCTTCTCCAAGATTCCCTTCTCGCAGAACCTTTGGTCTTA
CAGCATTTTTACTTACTTCATTCGTTACATATT

Sequences in the Contig:

SY0AAC1YH21FM1 SY0AAC46YE11FM1 SY0AAC47YI13FM1
SY0AAD1YD09FM1 SY0AAD41YA19FM1 SY0AAD8YM05FM1