Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig392
Length(NT) : 728
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: major allergen Asp f 2-like protein
Accession: gb|ABG77526.1| Score: 147 E_value: 6e-08
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03276 Score: 145 E_value: 5e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00746|ANG1_EMENI

Sequence:
>Contig392
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCCAGTGCTGGGATATGG
AAGAGGCGGCGTAAACGGTCCGGAGCGGAGAATATATTTGCCTTGTAGCT
CGCAACGTTCCGGCCCGAGTCGCGCGTCTGGGTGAGAGGGCGACGGGAGG
TGTATGAGAGCGGGAAAATGGCGGTCTCCGAGATGGCATTTGAACCACAC
TAGTGGCCTGCCTAGCAGGGTCGGGCACAGTTTTCGTCGATGTCGTAGCG
CAGGAGCATATCGAACTTGTTGGCGTGCAGGTTCCGGTGGGGAGGAGATG
GCTTTGGACGGCAGAGACGGGGTCCTGAGGGTTGTCAGTTCTGTCAATTG
GCGTTCAATGACATTGCACGACCCGTGGACCCCAATTCCCATGCATATGT
TGGTCAGCAAACATGTCTCTTCATCCTGATGGGCAACGCTCAGCACACGT
GGCCCGAGATACGGTGTATGATAGAAGCGGGGTCCCCGTGGCAGTACGGT
AATAGTTGTGATTGGGGCTCGGGTAGCAAGCACACCTGAGGCAAGGACGG
CCAAAGAAGAGATACCGAAGGCCTTCATTTTGATCATAAAGGTTTCGTCA
AACGTTCTTCCTAATTGCGCTGGACACACCGCTATATGAGAGACCAATTG
CCACGAAAAGGAGATGTGGGTGAAGCTCCAACAATTCCTATCTTCCGGCC
TCGCTTTTGTGCACAAATTCTCATCGCT

Sequences in the Contig:

SY0AAA22YM15FM1 SY0AAB34YE05FM1 SY0AAB47YH23FM1
SY0AAB53YB05FM1