Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3919
Length(NT) : 1283
Best Gene Model Blast : Link to GSTUMT00009802001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: hypothetical protein FG02646.1
Accession: ref|XP_382822.1| Score: 912 E_value: 3e-96
KEGG Definition: hypothetical protein
Accession: fgr:FG02646.1 Score: 912 E_value: 1e-96
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4400 Score: 270 E_value: 2e-24
PFAM Definition: No Hit Found
Swissprot: P53849|GIS2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0007242 = Biological process: intracellular signaling cascade

Sequence:
>Contig3919
TTGGCGGTACTCTTGATTCTTATTTTCGGGATAACTTTGGGCGGAATTGA
CTTTTTACATCTGGCTTTGGCTCCGAACCAGGTCTATCTTTCGAGAAAGA
AAAGAGGCTCCAGAAGAATTTTAGTCAAATCTTAAAAAGCCCACCCACCA
CTCACTGAACTATACGCCACCCTATCCTATTCTATTCCACGCCAGTCCAA
GCCGAGCGTAGTCCGTCCCATCGCCCCGCTACCCTCGATTCTTATTCTAC
TTCTTGTGACCATCACCCCCTCCTTCCTCCCTCCCTTCCCTTTACTTGCT
CCACCCTTGTGTTTTCTTCTGCGTCCTTTCTTACTTCATTGAGTCGGATT
CTTGCAGGGTGCGGTTGAGGAAGGAAGCGTGCGTGAAGTTGTGTGTTGAG
AGTAGAGAACGAGATCTTCAATCAGAGGAAATCGCCAGTATTTCAGATAT
TCGAATATTCGTCATGTCTTCGTTGTCTCGCAGAGCCTGTTACAAATGTG
GATCCATCGGCCACTTTGCTGAGGTTTGTTCATCGCCTGAGCGCCTTTGT
TACAATTGCAAGCAACCGGGACACGAATCCAATGGATGCCCGAACCCGAG
AACTACCGAAACTAAGCAGTGCTACCATTGCCAGGGCCTTGGACATGTTC
AGGCCGACTGCCCGACGTTGAGACTCTCTGGAGGTAGCGCTGCTGGAGGT
CGTTGCTACTCCTGCGGAAACCCGGGACATTTGGCACGGGCTTGCCCTCA
CCATCTTGCTGTTGGAAGAGGAGCTGGTGGATACCCTCGCGTGTATGTTG
CCGGATTTCCGGGCCGGGGTGGATTCGCCGGGAACCCACGCCCTGCAACA
TGCTATAAATGCGGAGGCCCGAACCATTATGCTCGCGATTGCCAGGCGCA
GGCTATGAAGTGTTATGCATGCGGGAAGCTAGGCCATATCAGTAGGGATT
GCCAGGCTCCTAATGGGGGACCCTTGAGCACTGCTGGGAAGACATGCTAC
AGATGTGGTGAAGCTGGTCATATCTCTCGTGATTGCCCGCAAGCCGCGGA
GCAGGCAGACCAGCAACCTGTTGTTAACAACGTTGTCACTGCATAGGCTG
GGCGGAGCCTACCAGTGTCGGTTTTTAGTTTTTTCCCTTGACTTTAATTC
AGTGAGGCATTTTGTTTTTATTGTTATTCCTTCTATATCGGTTTCTTTTC
GACCTATTTATTTAACATTCGCTGTGAATTGTTTTTCCAACTTCATTTTT
TCTCAATTTTTTATTCGGGCTTTGCTATGCATT

Sequences in the Contig:

SY0AAA63YA16FM1 SY0AAB36YF22FM1 SY0AAB3YN07FM1
SY0AAB50YD08FM1 SY0AAB58YH18FM1 SY0AAC11YN01FM1
SY0AAC1YG24FM1 SY0AAC48YE20FM1 SY0AAC56YF20FM1
SY0AAD19YM03FM1 SY0AAD22YM08FM1 SY0AAD25YK11FM1
SY0AAD33YO15FM1 SY0AAD38YH22FM1 SY0AAD4YL17FM1
SY0AAD5YC11FM1 SY0AAD6YN14FM1