Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3917
Length(NT) : 1070
Best Gene Model Blast : Link to GSTUMT00011062001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein An02g11460
Accession: ref|XP_001400273.1| Score: 876 E_value: 3e-92
KEGG Definition: hypothetical protein
Accession: ang:An02g11460 Score: 876 E_value: 2e-92
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2078 Score: 679 E_value: 5e-72
PFAM Definition: Met_10, Met-10+ like-protein. The methionine-10 mutant allele of N. crassa codes for a protein of unknown function. However, homologous proteins have been found in yeast suggesting this protein may be involved in methionine biosynthesis, transport and/or utilisation..
Pfam Number: pfam02475 Score: 536 E_value: 2e-55
Swissprot: Q8TFG7|TRM5_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig3917
TTGGGTCCATGCTCTGACTCAAGATACTTATCGATAAGACTCCCCTACCC
CTCGCTCCCAATAGCAACAACAGCAGAAGAAGAAGAAAAAAACAATAGTG
GGGAGAAAGATTAACGATATCATCAGATTCTAATGTCTAACCCTTCAAGC
GACGAAATGTCCCGTCTCTTCCTCCCGCCAATAAACCGCGCTATGCGAAC
ACTCGATCCATCATTCTTTCAAAAGACCATCCCACTGACGGCAGCGCATG
TTCTGGATGGGAGGAACATACCCAGGGTTACGAAGGAGTGTGCGAGGGAT
TTGTTGCGGGTCCCACGCCTGCGGAGTGTGATTACGCAGAAGGATGACGC
GGGGATGGAGAGAAAGTTGCTGCTGCTGAGGCCTGAGGTTAAACACGATG
ATTTGTCCACCGCCCAGCCGAAGACGAGGGAATTTGTGGAGGAGAGGATT
ATTAAGTTGGAGCCGTACACTCTGCACATGAAATATGAGAGCTGGAATTA
TGAAGAAATAATGAACGCGATTCTCCCAGAAGACCTCGAAGAGATTCCCT
GCGCTTTCACGCAGGCCGGGCACCTCGCGCACCTAAACCTTCGTGAACAA
TACCTCCCCTACAAACACCTGATAGCCACCGTTCTCCTGGACAAGAACCC
GAATGTATCCACCGTGGTGAACAAGATTGAGGACGTGGGTACAGGCTCGG
TATACAGAACTTTCCCCATGGAGCTCCTCGCTGGCCAGGATAATACGAAC
GTGGAGGTCCGGGAATCTGGCTGCGTGTTCAGGTTTGACTTTGCCAAGGT
TTACTGGAACAGTAGGCTCGGGAATGAGCACGAGAGGATATTCAAGAAAT
TCAAGCCTGGGGAGGCGGTAGCGGATGTGATGGCCGGCGTGGGACCGTTC
GCTATCCCGGCAGCGAAGCAGAGAGTCTTCGTCTATGCGAACGACTTGAA
TCCAGAGAGCTACAAGAGTCTAGTAGGCAATATTCACGTCAATAAGGTCT
CCCAATTCCTAACTCCCCACAACCTCGACGGCGCAAACTTCATCCGCGAA
TCCATCCGCACCCTCCTCTC

Sequences in the Contig:

SY0AAA37YG18FM1 SY0AAA50YA17FM1 SY0AAB12YJ01FM1
SY0AAB49YE11FM1 SY0AAC14YF05FM1 SY0AAC1YG19FM1
SY0AAD15YK20FM1 SY0AAD17YA08FM1 SY0AAD40YK04FM1
SY0AAD43YH14FM1 SY0AAD44YH14FM1