Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3916
Length(NT) : 611
Best Gene Model Blast : Link to GSTUMT00007514001 E-value : 6e-99
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_503451.1| Score: 444 E_value: 2e-42
KEGG Definition: hypothetical protein
Accession: yli:YALI0E02244g Score: 444 E_value: 8e-43
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1220 Score: 466 E_value: 1e-47
PFAM Definition: PGM_PMM_I, Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I..
Pfam Number: pfam02878 Score: 279 E_value: 7e-26
Swissprot: O74478|PGM2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig3916
TTGGGCGACCTCCCCCATTCACCGAAGCGAACGACTAAGTTACCTGCAAC
TGGACAAGATAAGATCGGCCCCACAATACTCTACTCGAGCTTACCTACCC
TCTCTCACGCTGCTGTTCTTACCGGTTGCGGTACGGTATCGACTGTTTGA
CTGGAACCACTTACTATGGAATCGATAGAAAATCTAGCGGAGCAGTGGCT
CGCTATGGATAATAATGACCGGACCAGGTCTGAGATCAGAATCCTCTTGC
AGGAAAAGAACACTCAGGAACTGGAAAAACGCCTAAGAACCAGAATCGAG
TTCGGCACGGCGGGCCTCCGAGCTCGCATGGAAGCTGGGTTCTCTCGAAT
GAACGATGTGACGGTGATTCAGGCTTCTCAAGGACTAGCAAGTTATTTGA
TTTCTGAATGCCCACAACCGGGCGTGGTGATTGGCTATGACCACAGACAC
AACAGTGAGCGGTTCGCAAAACTGACCGCTGCGGCCATGATACGATGTGG
AATTAAGGTATACTACTACGACTCACTGGTTCACACACCACTTGTTCCCT
TCGGTGTCGACTACTTCAAGGCGAGTGCCGGGGTGATGATCACGGCGTCG
CATAACCCGGC

Sequences in the Contig:

SY0AAC1YG17FM1 SY0AAD7YP07FM1