Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3915
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00003064001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein CIMG_00425
Accession: ref|XP_001246654.1| Score: 129 E_value: 6e-06
KEGG Definition: hypothetical protein
Accession: ani:AN4752.2 Score: 125 E_value: 9e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3915
TTGGAACACCAATTACAACGACGATGGAGAATAGAGATGACAATTCTGGT
GGATCTGGTGAGCTGCCGGGAATTACTCCTAGGCATTCAGTGGCTCCGGG
ATTAACTACGGAGGAGGCGGATAATGAAACTCCACAAGCTACTCTGGTAC
AACTGGCAAAAGTGGTCAACGCACCTGCTACACCCCCGCAGCAAACATCT
ACCTCAGCTGCGGCTGCATCACAGAAGAAATCAGTAAGGAGAACCCCCGG
CGCAGGAAGGCTTGCGCCATTGCCGAGTAAGCGCACCGCTAGATCTCCCC
ATGTCGTCCGCGCGTTCGAGCAACGTAGGGCGGTAACGCCAGGGCGTGAG
CGCAGAAAGAGTGGGAGGTATCCAGCTGCGAGAGAGACGCCGAGGGATTT
GTTGAGAGCTTTGAGTCGGCAACTCGCAACAACGTCCACCCAATACGTCC
CCTCCCCGGCACAGCCGGCCCCGCGCCCCGCCCCTCGCCCCTCATACTCT
GACCGCCGTGCCTCAGACGTCGTATTCTACAGCGACCCTGGACACAACTC
TGGAGATGAAGACGAGGAGCTCTCGCCCGCGCCGAGGCTAAGCATGAATC
TGAATGAATTCGAACAGGCGGAGGAAGAAGAGGACGCCCGTCTTCCAGTC
CCAAGATATTCACTGCCGCT

Sequences in the Contig:

SY0AAA21YB02FM1 SY0AAA23YF24FM1 SY0AAB58YB13FM1
SY0AAC1YF07FM1 SY0AAD3YF15FM1