Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3914
Length(NT) : 1005
Best Gene Model Blast : Link to GSTUMT00004236001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_02490
Accession: ref|XP_001793096.1| Score: 598 E_value: 5e-60
KEGG Definition: UBX domain protein
Accession: afm:AFUA_1G14320 Score: 577 E_value: 7e-58
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1363 Score: 318 E_value: 4e-30
PFAM Definition: UBX, UBX domain. This domain is present in ubiquitin-regulatory proteins and is a general Cdc48-interacting module..
Pfam Number: pfam00789 Score: 115 E_value: 1e-06
Swissprot: O74498|UCP10_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig3914
TTGGAGGAATTAAGGTTCTTATTAGTAGTTCTTCAAAGCGACGAACATGA
TGACACGGCATCTTTCAACAGAGAAACATTGATAAATCCTGAGGTTGTTG
AATTTATTAAGACACAGAACATTATTCTTTGGGCTGGGAGTGTCCAAGAC
AGCGAGGCATACCAAGTTTCAGCGGCCCTCAATTGCGCCAAATTTCCTTT
CGTTGCGCTAATAAGCAGAGCTCCTTCACCCGGTAGCTCCCAGGGAATGT
CTGTTGTCTCACGCATTGTTGGGCCAACACCACCACAGACCCTCGTCTCA
AAGTTGACGGCTGCTATAATGACCCATTCCGAGACCCTCGAGCGGGCCCG
TGCCACCCGCGCCGTACACGAAGCAGGTAGAGCCATCCGTGAACAACAAA
ACTCAGCATATGAGCTATCCCTCGCCCGAGATAGGGAGATAGCCAGGGCG
CGCAGAGAAGAAGCAGAGAGAAAGGCTAGGGAAGAGGAACTCGCCCGGGC
TAGAGCGGACGAGAAGGTATTGCTGGCAAAGAATAGGACTGCGTGGAGGC
AGTGGAGAGCTACAACCATCCCGAAAGTGGAACCAACTGGCAAGGATACA
GCTAGGGTTAGCATCAGATTGAGGAACGGTGAGAGAGTGATCAGACGGTT
CAATGGGGACGCCAATATGGAGGAGGTGTACGCCTTCGTGGAGTGCTTGG
AGTATTTGAATGAGAGTGCAACCAACGAGAAAACGCCGGAGAAACCAAGT
GGATACACCCACGAGTATGGATTCAAGCTAGTCAGTCCGATGCCAAGGCA
GGTATATCAGCTGCAAAGTGAGAAGGGTGGATCTGAAAGCGCTGTCAAAG
ATTGTCTATGGCCTACCGCAAGTCTTGTCGTCGAAGTTGACGATGATGAA
GACGATGAGGGGGGAGAGGATAATTAGCTAAGATGGACTAAAAGAGAACC
GGAATGTCAATTTTATGCAACACTACTGGTATGTAGAGTGTATCTGGTCG
CACCA

Sequences in the Contig:

SY0AAB4YG06FM1 SY0AAC1YE20FM1