Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3913
Length(NT) : 550
Best Gene Model Blast : Link to GSTUMT00006491001 E-value : 3e-94
Numbers of ESTs : 2

Blast Results:

Nr Definition: alpha-actinin
Accession: ref|NP_594295.1| Score: 202 E_value: 1e-14
KEGG Definition: hypothetical protein
Accession: spo:SPAC15A10.08 Score: 202 E_value: 7e-15
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0517 Score: 117 E_value: 3e-07
PFAM Definition: No Hit Found
Swissprot: O13728|AIN1_SCHPO
Gene Ontology:
GO:0005826 = Cellular component: contractile ring
GO:0003779 = Molecular function: actin binding
GO:0030674 = Molecular function: protein binding, bridging
GO:0051017 = Biological process: actin filament bundle formation
GO:0000915 = Biological process: cytokinesis, contractile ring formation

Sequence:
>Contig3913
TTGGCGGAAATTTCAGCAGCAACGAACGAAGCTCTTCATTCACCTTGGTT
CGCCCACACTCCCCTCTTAACCATCACCGCTACCTTGGGGGAAGAGGGAA
TACTGTACCTATTCTTACAGAGAAGTTCTTGTTGAGGAAAGAAAGGAAAG
ATGGCTCAACAACAGTGGATCACTACGCAGGATAAGACGTTCAGGAAGTG
GTGAGTCGGCGATTCCATCCGTCCCTCACTTGTGAGCCTCGTGCCTCCTC
CCCGTCTATCCCCCCCCCACTACCCGATCCAGGGGAGGCGTCGGCGCGAT
ATGAGATGTTTTGCTAGTCACACTCACTGACATTGACGATCCATCGACAA
AAAACAGGCTCAATACAAAGCTATCTGCTCGAAACATCCCCCCCGCACAA
TCTTTGCAGAAGGACCTAGCTACTGGAGTACTATTGATCCATCTCCTCGA
AATTCTCGGCAATGAGTCTCTAGGAAAATATGCGTCTAATCCACGACTAC
GGGTTCAAAAATGCGAGAATGTTCACAAAGCTCTCGAATATATTCGTGGC

Sequences in the Contig:

SY0AAC1YE07FM1 SY0AAC57YK23FM1