Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3911
Length(NT) : 769
Best Gene Model Blast : Link to GSTUMT00011710001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: transcription factor TFIID complex subunit Taf11
Accession: ref|NP_593491.1| Score: 200 E_value: 5e-14
KEGG Definition: hypothetical protein; K03135 transcription initiation factor TFIID subunit D9
Accession: spo:SPAC1002.04c Score: 200 E_value: 2e-14
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3219 Score: 272 E_value: 6e-25
PFAM Definition: TAFII28, hTAFII28-like protein conserved region. The general transcription factor, TFIID, consists of the TATA-binding protein (TBP) associated with a series of TBP-associated factors (TAFs) that together participate in the assembly of the transcription preinitiation complex. The conserved region is found at the C-terminal of most member proteins. The crystal structure of hTAFII28 with hTAFII18 shows that this region is involved in the binding of these two subunits. The conserved region contains four alpha helices and three loops arranged as in histone H3..
Pfam Number: pfam04719 Score: 261 E_value: 1e-23
Swissprot: Q99JX1|TAF11_MOUSE
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig3911
TTGGACAAGCACTCCACAATCACGACAATAACGAACAAAATAATGTCCTC
TCCCCCCTCCGTATCCTCCCCACCATTCTACCCCCCAGGCTCCCACAAAC
GCAGAATCTCGATAACCGGCTCCTCTTTACCACCGCCCGCCGCCAAAAAG
CCCAAGATCCCTGCACCCCGGAAGCTCTCGACCTTCGCGCAGCCTTCATT
GCACCCACTCCGCCAGACCTCCTTCCCACCAGACCCGCCGCCACCCGGCG
CGAAGGAGGACGAAGAAGACGACGATGCGCGGGAGGATGATTACGGAACT
TCCACCGTTCTGGCGGAGGGCGCTGCCGGGAATTTCGGAGGGGAGGATGA
CGAGAAGATCAAGCTCTCTGTCCTCCTAGACTCCTTCGACAGCCAGCAAA
CACAACGCTATGAAGCCTTCCGGCGCGCGAATCTTAACAAAGCCGCCGTC
AAAAAGCTTGCCAATCAGGTCCTCTCGCAGAGCGTCACGGCTGGGGTTGG
TACGGCGATCTGCGGGTTTTCAAAGGTTTTTACGGGAGAGATTGTGGAGC
TTGCGCTGAAGGTCCAAAAGGAGTGGGCAGATGCGGACGTTGAAGGAGAG
GGGATTGAGAATATTCGGAAGAGGACAAAGTCGGATGGCAGTCTTGGCCC
TCTGCTTCCCGATCACTTGAGGGAGGCCGCGAGAAGGTACAGGCTTGAAC
TCCGTGGGGCTGTTGGTTTTAGAGGGTCTATTGGGGGTGGATGCGGAAAT
GCCCTTGGCGCTGGCCCGG

Sequences in the Contig:

SY0AAC1YB21FM1 SY0AAC52YJ04FM1 SY0AAC59YK24FM1