Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3910
Length(NT) : 1130
Best Gene Model Blast : Link to GSTUMT00001395001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: protein kinase C homologue
Accession: emb|CAC01625.1| Score: 1621 E_value: 1e-178
KEGG Definition: protein kinase C-like [EC:2.7.11.13]; K02677 classical protein kinase C
Accession: ani:AN0106.2 Score: 1516 E_value: 1e-166
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0694 Score: 1309 E_value: 1e-145
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 535 E_value: 3e-55
Swissprot: O42632|KPC1_COCHE
Gene Ontology:
GO:0004697 = Molecular function: protein kinase C activity

Sequence:
>Contig3910
TTGGGGCGGAGACAAAGGCTTCTAAGAAGCTGTATGCTATTAAGGTTCTA
AAGAAGGAGTTCATCATTGAGAATGATGAAGTTGAGAGTACGAGGTCGGA
AAAGCGGGTGTTCTTGATTGCCAACAAGGAGCGCCATCCCTTCCTACTGA
ACCTCCACGCTTGTTTCCAAACGGAGACTCGTGTTTACTTTGTCATGGAG
TATATTAGCGGAGGGGATTTGATGTTGCACATTCAGAGGGGCCCTTTCGG
ATCTAGGAGAGCGCAGTTTTATGCTGCCGAGGTTTGCTTGGCATTGAAGT
ACTTCCACGAGAACGGAGTGATCTATCGTGATTTAAAGCTCGATAATATT
CTACTCACACTTGATGGGCATATTAAGATCGCCGATTATGGTCTTTGCAA
GGAGGAGATGTGGTATGGATCTGCTACAAGCACCTTCTGTGGTACTCCTG
AATTTATGGCGCCGGAGATTCTTATGGATAAACGCTATGGCCGTGCTGTT
GACTGGTGGGCGTTTGGTGTGTTGATTTACCAGATGCTTCTCCAACAATC
CCCCTTCCGTGGGGAAGACGAAGATGAAATTTATGATGCTATTCTTGCTG
ATGAGGCCTTGTACCCTATTCACATGCCTCGCGATTCGGTATCTATTTTA
CAAAAGCTTCTGACGAAGGAGCCTGAGTTGCGTCTTGGGTCTGGGCCTAC
GGATGCGCAAGAGATTATGTCCCACCCATTCTTTGCCAATATCAATTGGG
AGGACATTTATCACAAACGCATCCCACCTCCTTTTAAGCCGTCAATTCAA
TCTGCCACAGATACTTCCAATTTTGACCAGGAGTTTACCAGCGTCACCCC
TGTGCTCACTCCCGTGCAGTCAGTGCTCACCCAAGCCATGCAAGAGGAAT
TCCGCGGCTTCTCCTATGTGCAAGATTTCTCTTAATAGTAGTTTTCCAAA
AGACGTTCGTTCTCATAAGAGGACTCAGACCCCTCCCCCCCATTTCTATA
CAAAGACAGAAACCCATTATGTTATTTTTTGCTCAAATGTCTTTCTTTTT
TTTCCCCTTCCTCCTATTTTTTGCTTCTTCCGCCAGGCGTTATTTTTCGT
GTATCAGGAAAGTCCCTGAACTGTCCTCTC

Sequences in the Contig:

SY0AAB13YE16FM1 SY0AAC1YB04FM1 SY0AAD3YD22FM1