Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig391
Length(NT) : 1069
Best Gene Model Blast : Link to GSTUMT00003265001 E-value : 1e-152
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_06688
Accession: ref|XP_001592447.1| Score: 368 E_value: 3e-33
KEGG Definition: hypothetical protein
Accession: yli:YALI0D23815g Score: 339 E_value: 3e-30
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0558 Score: 328 E_value: 3e-31
PFAM Definition: Biotin_lipoyl, Biotin-requiring enzyme. This family covers two Prosite entries, the conserved lysine residue binds biotin in one group and lipoic acid in the other. Note that the HMM does not currently recognise the Glycine cleavage system H proteins..
Pfam Number: pfam00364 Score: 168 E_value: 1e-12
Swissprot: P11182|ODB2_HUMAN
Gene Ontology:
GO:0005947 = Cellular component: mitochondrial alpha-ketoglutarate dehydrogenase complex

Sequence:
>Contig391
TTGGCTCCTCCTTCTCGTGCCAATCTATCAAGGGGTACTGTATCAGTGGG
GAGTGACTCTACCTGTGCGGTTGCGGTAAACTTTGCTGGTAAGCTCCAAC
CCAGTGCAGTACCGGTACCGTGCTTTACTCGAGTAGAGTCCAACCGGGGA
AGAATTCAACTCCTCGCCTTCCCCGCAAAAAAAGCCCCCCAATCACACAC
ACCTTACACGGCTATCGACGGCTCAGTCAACAGCATCCACTGTGGCCCGT
CCCGTCTCGGATATAGACCACAAGTACTCGTACCCGACCCGCAACGCGCA
TATACCATACATACTCGAGTACGGTACTGTACATTACATCCTTTTCACTT
CATTTCGATCTCATAAACTTCACCACTCTTTCTTTCTTTTCTTTTCTTTT
TTCTTCTTTTTACCTTTGGAAATAGGGATAAAAGAAGAAATAGAAAGGAA
CTCCTTCCGGAATCACACGTTTGGCCCCCCTTTACTTGCCTGCAGGCTAT
ACTTGAGGCGGGAATTAAGGTTTTATTTTTGTTTTTTATTTTTAAAAGGA
AAAAAAAATAAAAAAAGAGAGAGAGAGAGAGAGAAATTGCTGTCGTGTGT
GGTTTGCTTACTCGGATAAAAGGAGGAGCAGAAGATGCTGTGGGGCAGTA
CCGGCAGTCGAACGGTTGTGCGAGCTAGATTTTTCCGGAGGAGTAACAGC
AGCAGCAGCAGCGTCAGAGTCCTCCCTCCATTTATTACTACCACTGCAAG
ATCGTCGTTGTTGTCTGTATCGAAGTTGTCGAGGTCAAGGGGGCTCAAGA
GTTCTGCTCGGGTGCTTGTCGTGAAACCATTCTTACTCGCGGATATTGGT
GAAGGAATCCGTGAATGCGAAGTCATACAATGGTTCGTTCAGCCAGAGGC
TAGAGTGGAGCAGTTTGATAAGCTTTGTGAGGTTCAGTCTGATAAAGCTT
CTGTTGAGATCACTTCACGCTACGATGGGGTCATCAAAAAGTTGCACTAC
GAGGCCGGGGACATGGCAATTGTTGGAAAGCCTCTCGTCGACATTGACCT
TCAAGCCGACATCAACGAT

Sequences in the Contig:

SY0AAA13YD09FM1 SY0AAA22YL10FM1 SY0AAC44YG14FM1
SY0AAC9YM20FM1 SY0AAD40YC06FM1 SY0AAD48YB16FM1