Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3909
Length(NT) : 797
Best Gene Model Blast : Link to GSTUMT00002174001 E-value : 1e-161
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_07585
Accession: ref|XP_001590961.1| Score: 249 E_value: 2e-31
KEGG Definition: hypothetical protein
Accession: ang:An02g02260 Score: 234 E_value: 4e-27
KOG Definition: No Hit Found
PFAM Definition: Nodulin-like, Nodulin-like. This family represents a conserved region within plant nodulin-like proteins..
Pfam Number: pfam06813 Score: 133 E_value: 7e-09

Sequence:
>Contig3909
TTGGGCGCAATACGGCATTATCTATTCATCTGTCACATTCGTTCGTCGTT
TTTCCGGGAGGGAAAAATGAAGCTCTAATCCATCGCCGGCTCCAACACAA
TCTTCCTCACCAAACACTCCAACTCCCTAACTTAGATGCGGTTGAAGCTG
TCGCTAATACCCTGATCCTGCGCTTATACTCTCCCCACTACCTTATTCTT
TTCCAGACGCCCTCTAACTTCGTGAGCTATCGGTCGTTATCTTCGGGGAG
TCTCGCGCTACAGAATTGTAGCATCTCTATACCGGTAGAATGCCGGAGAG
GCACTTGCGTATTGCCCGCTTCGTGAGCTTAGCTGCCTCGACATGTATTT
CACTAGCCTGTGGGACAAATTATGTCTATTCGGCCTATGCCCCCCAACTA
GCCACTAGGCTCCACCTCACTGCGACGGAGAGTAATTTGATTGGAACATT
TGGGAATTTAGGAATGTACCTTTCGGGGATACCAAGTGGAATTCTAGTGG
ACTCTAAAGGGCCCCGGCTGCCTCTTCTCATAGGTGCTGCGGCATTGCTG
ATTGGGTATTATCCAATGTATCTAGGTGAATGACCTAACCCTAATCCCTC
CAGAGTGGCCAGGCATGATCTAATCCTTCCTAGCCATGGAGGGTGGGAAG
GGATCGACGAACGTCTTCGCGTTGTGCTTTTTCTCCGCACTCACAGGTGT
CGGGAGTTGTTGCGCCTTTGGTGGAGCCATGAAAGCTGCTGCTCTCAATT
TCCCACAGAATCGAGGGACAGCAACGGCTCTGCCCTTGGCGGCTTTT

Sequences in the Contig:

SY0AAC1YA20FM1 SY0AAC28YO02FM1