Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3908
Length(NT) : 909
Best Gene Model Blast : Link to GSTUMT00010375001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_10390
Accession: ref|XP_001800661.1| Score: 458 E_value: 9e-57
KEGG Definition: acyl-CoA synthetase
Accession: aor:AO090012000579 Score: 384 E_value: 6e-51
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1176 Score: 348 E_value: 1e-33
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 274 E_value: 4e-25
Swissprot: P31685|4CL2_SOLTU
Gene Ontology:
GO:0016207 = Molecular function: 4-coumarate-CoA ligase activity

Sequence:
>Contig3908
AGGGGAGCGTCTTTATGTTTGATGAAGGGTTGGATATAACGGCTGATGGG
AAGATTCTTGGGTGGGGGGATAAATCAAGTCCTGGTCGGACACGGCATTG
GAGCGATATTGTAGAAAAAGGTTATGATGGGTTTGTCTGGCAGGAGCTCA
AGACCGATGAAGAGCTCGACACTACCGCTGCAATTAACTACTCCTCTGGG
ACCACCGGCGTCCCAAAAGGCGCCCAAATCACTCACAGAAATATCGTCAC
AAACGCTCATCAAGTGGTCTCTCTGCGCATGCAGTCCAATTCTGCTCCCA
ATGACTCTCGCTGGCTAGCCATGCTACCAATGTATCACGTATATGGCCAA
ACCTATTACGCAATCATTGCGCCCAAACTTCGAGCTCTCGTCTACATGCT
TCAAAAGTTTGACTTTGGAGCCTTCTTAACGACGATTCAAAAACACAAGA
TTACCACTATTGCCGCTGTACCCCCAATTATGGTTGCCCTGGCAAAGCAC
CCCGACGTCATAAAATTCGACCTTAGCTCCCTGAATGTATTAGGATGTGG
AAGTGCGCCTTTAAGTAGAGACATTTCGAGGGAGGTGGAGGAAAGGGTAA
TGAGGGGCCGGGCAGGAGAAGAAAGAGTAAACTTGAAGCAGGGATGGGGA
ATGACGGAGTATTATGAATTACCCTGCTGGGGCTATGGCATGAGCTGACA
TTGGTACGTGTGGTAGGGCTACCTGCTCGGTCACAGGCTTCCACCCAGAT
GACACGGATGAGGAGGGTTCTGTCGGTGAATTGCTACCGAATTGTGAGGG
CAAGGTCATGGACGCCGAAACTGCAACCCGGGAACTCCCCCCGAATACCC
AGGGTGAGATTTGGGTTCGAGGGCCTATCATTATGAAGGGATACTATAGA
AAACAAGGC

Sequences in the Contig:

SY0AAC1YA19FM1 SY0AAC1YO14FM1 SY0AAC31YI17FM1
SY0AAC55YK03FM3 SY0AAD22YP16FM1