Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3907
Length(NT) : 747
Best Gene Model Blast : Link to GSTUMT00008843001 E-value : 1e-102
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3907
GGTCGAGCGGGAGCTTACGCTGGCGGATCAATTACAGTGAAATTGGGTTA
GGTTAGGTTAACGGGAAGCCTTTATATAACAACAATGGTTTTTGGAGGAG
AGGTTGTTGCACTTACGATCGATTTCTGCTCTAACTTCCCGAGGAGGTGG
AGGGGATAATACGCAAACGCAAACGGGAACCCGAGCACGGAACAGCACGG
TAGACGACTACTCCTAAGATAAACGTTTCCAAAAAATCGGGGAAAATTGA
TTTGGAGAGAGAGAGACCGAGAGATCGAGAGAGTAATTGACTGCGAGGGG
AAACACCAACGAATGAGAATTCCCTACGAAAAGGGTCGAAGCAAAGGAAG
GGAAAACCATCACTACCGACCAGTGATGGAATGGAGCACAGATTTCCAAC
GAAAGCGGCCTCCAAGCGATGACCTGCTGGAGGAACAGCCCTTATCGAAA
CGTCTGGAGAAACTATCTCTCGTCAAAAAAGTAGAGCTTCTTAACAAACC
CCGACTCTTCCCCACCACCACCCCCTCCAGTGGCACCCCCCTCTCCCAAA
CAGAAGCCGAAAGAATGGACGTCGACAATGTGATCTTTATCAAAAGTCTC
GACGAAGAGATCGCGTCCTACGACTCTGAGGACGACCCGGACTCCCGGAA
ACTCATCTTCCTCTCGGACGTTGAGAAGCAGCTGACACGGGTTCCCTACC
TGCTTGCTGAAAGTGGTGCCCATAGTGGTGGCGGTGGGGGGGGGAGA

Sequences in the Contig:

SY0AAA13YO08FM1 SY0AAA26YN09FM1 SY0AAA37YL06FM1
SY0AAA37YO12FM1 SY0AAB39YC16FM1 SY0AAB52YH16FM1
SY0AAC1YA18FM1