Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3906
Length(NT) : 1490
Best Gene Model Blast : Link to GSTUMT00011025001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3906
TTGGATCTTGTAGACGCAAGCACCAGCACCGCTGATCTGAATGAAGATCG
TGCCATGGGCACTTCTCACCCTTGGACCTCAAGTCCGCCACCGCGGATAT
ATGGAGAAAATGTTTCAACGATACCGAAGCAGATGCCCGGCGTTACCAGC
CTAATGGCGCAGCTCAAAGATAAGGTCACTTGTGATCGGGCAGTGAGTGC
GAGTGCAGTATCTGAGACCGCAACTAACGGTCTTTATCTTCTAAGCCCAA
TCGAATTCTCCAAAGAAAATTCACCCACGGGGCCCAAAGTCCATAACGCG
ACCCACGACGAAGAACTATCAATACCCGATGGTCTATCCAAACTCCCCAC
AACCCAGAAGCTTCAAAGTCTGGTTATACTGCCTGAGGAAGATGAAGATG
TTGTTGTTTGGGATGCGAAAGAGAAAAGGGGAGGGTTCACAGCACTTAAA
AGAACGGAAACTAGACATACTGAGGTTGATGAAAATGGAAGCCCTTCTAG
ACAGCGGGTCCCAAAGCCACCAGCGGGGCCAAAAAGAGTCTCATGTGAGA
TATTAGACGAGCCAAAGGATCCTGCTCCTGAAGCCCCTCAAGAGCCGGAG
ACTGAGGAAAACGTGTTCGTCAAAAGCACAACCAGCATCCTGCGTGAGAG
AACCTCATTGGGCGGACAGCTGTTTGTAGAGAAAACACCCCATCTGGTCA
GGACTCGCGCAAAGGGCGGTAAGCATAGGAACCCAGGAATTAGCACTAGT
TATGAGGGGGGCAGGGGGTATTTTAAACAAAAGGATAGTGCGACTAGGCA
TATCGATGGGCCCAAGAACAAATCTACAGAACTACCAAAACCGTTTGAAA
AGTTTCATGAAAAGGAGAGGGATGTGATTTCAATATCATCGACATCGCCT
GCCCCGGCTTTGCCCATTGCTCTTCCGCCAAAGAAATCACACAGGGTATG
CCAAGAGCCAGAACTTCGGGAGGACTCAGACGACGCAGAATCTATAGAAC
CCGCGGTGGCTAGGGTCTTGAAAATACTTGCCGAGACGAGCACCAGCATA
CCCAAATCCTCACCTCCTGTTCTCCATCATTCAAAGCCGAAAGTTCAACT
TATCAGGAACGGTAAGCGGAAGCTTGGGGATAATAATAACTTGGTCCAGG
GTGCAAGAGTTGAGACCATTAGCACCGGAGATAGACCGTTCGAGGACACG
GTTTTAGCTAGAAAGGGGCATCCAGAGACACATTTTTCCAAGATGCTACG
AAAACAACGATTCGTAAGAATTCAGAACCCGCCTTACCGCGGGAATCCTC
CCAACCGGCGATTGGCAGAGGAGCAGTTCCGCAGAGCTTCTAGGGTGGTT
CCCATCAATGGAGAACATGTTCGGAGACAGGAGCGGATTGAGGATTCTGT
TCAAGGTGGGCTGGATGGGGATACTGAGGTTGAGGATTCTATGAACGCCT
ACACAGATGATAATGGTTCCGATATAAACACCGATACGTG

Sequences in the Contig:

SY0AAC1YA16FM1 SY0AAC46YJ17FM1 SY0AAD36YK01FM1
SY0AAD9YP09FM1