Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3905
Length(NT) : 1211
Best Gene Model Blast : Link to GSTUMT00005884001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_08991
Accession: ref|XP_001799294.1| Score: 678 E_value: 4e-69
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06912 Score: 655 E_value: 9e-67
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4696 Score: 228 E_value: 1e-19
PFAM Definition: Peptidase_C78, Peptidase family C78. This family formerly known as DUF1671 has been shown to be a cysteine peptidase called (Ufm1)-specific protease..
Pfam Number: pfam07910 Score: 366 E_value: 1e-35
Swissprot: Q3T9Z9|CF113_MOUSE

Sequence:
>Contig3905
TTGGCTTCTTTGGTGCCCTCGAAAACACCAAGTCATTTGAAGTCACCTAA
GAGGTCTCATAAGTTGGTGTTTGGTCTGCCGGTTAAGGACCCGTGGAGGC
AGAGGGAGAAGGAGAAGGAAAAAGAGCGGGAGAGGGAGAGAGAGCTGGAA
AGGGAGAGGGACAGGGAGAGAGCTAGGGAGGTTCGGAGGCCAGTTGAGAG
AAGTGTGGTCAGGCCTATTGATGGGCAAAATCTGCCTGGGCAGCAGCAAA
CGGTATCCTCTAATCATATTCTTACTCCAGTCAAGCGGTTAGGAAAGAGT
GATCTAGGACCTTATGCCCACGAGGCACAAATGCCGGCTTGGCTCCGCAA
AGAGCTTGAGCAAGGTGGTAAACTGACCAAGGAAACTAGATTGGATCATG
CCGCTGGGCGTTTGGTTAGGGTTGTCACGGTCTCCAATGAAACTCCCGAT
CTCATCCCTGTGATTGCGCTTCTCTGTGAACACGATCCTCGTGTCGTGAG
GGCATGGGTTTGCCATCCGGGCACCAAACATGTTGGGAAACAGATTAGGG
GTGAGGGCGGCTTCTGTGGGTATAGAAATATTCAAATGGTCGTCAGCTAT
ATTCAGAATGCATACCCTAGGGGATCCCATCCGTTTGAGGGCAGAATTCC
GACTATACTGAGGCTTCAGGATTGGATTGAAGAGGGATGGGATAAGGGAA
TAAATCCTAGCGCTAGATTGGAGACTGGCGGTATCAAGGGGACCAGAAAA
TATATTGGGACTTCAGAGGCCCAAACAATGTTTGTCAACCTTAACATCCC
CTGCCGTCCCCATAGCTTCACCAGGTCAGAAGGCCTCAAAACCCAGGAAA
AGCTTCTTGACTGGGTGGAAAACTACTTCTCTGACGGCGGCATCCTCCCA
GAAGCCGCCCAAGTAAAGGTTTACCAGACCCAGAAACCCCCAATCTACTT
TCAGCACAGCGGCCACTCTATGACAATAGTCGGGTGCGAGACCAACAGGG
ACGGTTCCAAAAACCTCCTAGTCTTCGACCCCTTCTTCACACCCTCCGCT
CCTATGAAGAACCTTATTGGCGCGCGTTCCCTGAGCCATAGAATGGACCC
GGAACTACTCCTCAGGGCCTATAGGCGCAGGATGAACTACTTGCAAAAGT
ACAAGGAGTTTGAAGTTATAACCTTGGATTCTTGATGTCCTCCTATCCAC
CTCCGTACCTG

Sequences in the Contig:

SY0AAA63YO18FM1 SY0AAB58YO06FM1 SY0AAC1YA14FM1