Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3904
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00001848001 E-value : 1e-101
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 418 E_value: 2e-39
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 404 E_value: 3e-38
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 230 E_value: 3e-20
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>Contig3904
TTGGGGCTTCTGAACAGGGGCACTCAGGGGTGGTTAAGCTACTATTGGGA
AGAAAGGATGTTAAACCTGATGCGGCTGACGGGTATAGCCGCACACCTCT
CATATTGGCTTCCAGGAAAGGGCAGGAGGCAGTTGTGATGTTACTAGTGG
AACGAGAAGATGTCAACATCGATAGGCCGGACACAAACGGTGATACACCA
CTCTTGTACGCTACTCGCTACGGGTCCTCGCGGGCTGTGGAGCTACTACT
AGGAAGGAAAGATGCCGAATCTGAAATGATGGGGGGATACTGCCAAACAC
TGCTTTGGTTGGCTGCCGAGAAAGGGCATGATGGAGTAATGAAGCTATTG
TTGGGACGAGAAGGCGTCAACCCCGATAAGCCAGACGATTATGGCCAGAC
ACCGCTCTCGCTTGCTTCCCGTAACGGACACGGTGGAGTGGTGAAGCTAC
TGTTGGGACGAGAAGGCGTCAACCCCGATAAGCCAAACAATTATGGCCGG
ACACCGCTCTCGCTTGCTTCCCGTAACGGACACGATGGAGTGGTGAAGCT
ACTGTTGGGACGGGAAGGCGTCAACCCCGATAAGCCAGACAATGATGGCC
GGACAC

Sequences in the Contig:

SY0AAB21YN01FM1 SY0AAC1YA06FM1